ID: 1101469016

View in Genome Browser
Species Human (GRCh38)
Location 12:104977704-104977726
Sequence GGTGACCAAGAACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 7, 3: 21, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101469016_1101469019 -2 Left 1101469016 12:104977704-104977726 CCAGCTTCTGGTTCTTGGTCACC 0: 1
1: 0
2: 7
3: 21
4: 218
Right 1101469019 12:104977725-104977747 CCAGGCTCCTCACTCTGTCCAGG 0: 18
1: 24
2: 13
3: 45
4: 394
1101469016_1101469022 5 Left 1101469016 12:104977704-104977726 CCAGCTTCTGGTTCTTGGTCACC 0: 1
1: 0
2: 7
3: 21
4: 218
Right 1101469022 12:104977732-104977754 CCTCACTCTGTCCAGGTAGGAGG 0: 23
1: 21
2: 8
3: 22
4: 182
1101469016_1101469023 10 Left 1101469016 12:104977704-104977726 CCAGCTTCTGGTTCTTGGTCACC 0: 1
1: 0
2: 7
3: 21
4: 218
Right 1101469023 12:104977737-104977759 CTCTGTCCAGGTAGGAGGCCAGG 0: 21
1: 23
2: 18
3: 56
4: 443
1101469016_1101469025 22 Left 1101469016 12:104977704-104977726 CCAGCTTCTGGTTCTTGGTCACC 0: 1
1: 0
2: 7
3: 21
4: 218
Right 1101469025 12:104977749-104977771 AGGAGGCCAGGCAGTCGTTCAGG No data
1101469016_1101469020 2 Left 1101469016 12:104977704-104977726 CCAGCTTCTGGTTCTTGGTCACC 0: 1
1: 0
2: 7
3: 21
4: 218
Right 1101469020 12:104977729-104977751 GCTCCTCACTCTGTCCAGGTAGG 0: 20
1: 19
2: 8
3: 29
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101469016 Original CRISPR GGTGACCAAGAACCAGAAGC TGG (reversed) Intergenic
900408361 1:2502246-2502268 CCCGACCAAGAGCCAGAAGCCGG + Exonic
903522484 1:23961439-23961461 GGTGACAAAGAAGCTGAAGATGG + Exonic
903805792 1:26004898-26004920 GGTGACCAAGAATGAGGAGGTGG - Intergenic
903827443 1:26156239-26156261 GGGGACCCACAACCAGAAACAGG + Intergenic
903995851 1:27305126-27305148 GGTGGCCAGGAAGCAGTAGCTGG - Exonic
904901772 1:33863286-33863308 TTTGACCAAAAGCCAGAAGCCGG + Exonic
905688570 1:39926419-39926441 GGAGACCATGAAGCACAAGCTGG - Intergenic
907357222 1:53886217-53886239 GATGAGCAAGACCCAGAAGATGG + Intronic
908822783 1:68104958-68104980 GGTAACAAAGAACCAGAGACAGG - Intronic
909577478 1:77190783-77190805 GATGGCTAAGAACCAGCAGCAGG - Intronic
909614947 1:77597204-77597226 GGTTCCCAACAACCAAAAGCTGG + Intronic
910021977 1:82602670-82602692 TGTGACCAAGAAAAGGAAGCAGG + Intergenic
911232533 1:95376260-95376282 GATGACCAAGAACCATGAGAAGG - Intergenic
911479665 1:98422233-98422255 GGTGACCCTGAAGCAGAGGCTGG + Intergenic
912673053 1:111649255-111649277 GGAAACCGAGAACCGGAAGCTGG - Intronic
913342974 1:117778503-117778525 GGTGACAAAGAAGCTGAAGATGG - Intergenic
914380028 1:147107388-147107410 GGGGACAAAGACCCAGAAGCTGG - Intergenic
915118956 1:153616676-153616698 TGTGACCAGGAAGGAGAAGCAGG + Intronic
915488180 1:156236384-156236406 GGAGGCCGAGAACCAGCAGCTGG + Exonic
915632158 1:157161010-157161032 GGAGACCAAGAACCTGGTGCAGG - Intergenic
918139949 1:181711760-181711782 GGTGCCCAAGGAGCAGAAGGGGG + Intronic
918276739 1:182960041-182960063 GGAGACCAAGAACCGGAAGCTGG - Intergenic
922568420 1:226617186-226617208 CATGATCAAGAACCAGAAGGAGG + Intergenic
923914942 1:238491656-238491678 GGAGACTGAGAACCAGAGGCTGG + Intergenic
1063498923 10:6536007-6536029 GGTGACCTAGAACCAGGGGTAGG - Intronic
1066732385 10:38448097-38448119 GGTCACCAAGATGCAGGAGCTGG - Intergenic
1067283552 10:44891081-44891103 GGTGGCCAAGAGCCAGTAGCTGG - Intergenic
1069747208 10:70723234-70723256 GGTCATCAAAAACCAGAAGGTGG + Intronic
1070286197 10:75085623-75085645 AGTCACCAAGAACCAGAGGCAGG - Intergenic
1070989011 10:80715149-80715171 GGTGAGCAAGAATTAGAGGCTGG - Intergenic
1071138071 10:82474657-82474679 GGAGTCCAAGAAAGAGAAGCAGG + Intronic
1074298090 10:112209594-112209616 GGGGACCATGAAGCAGCAGCAGG - Intronic
1076171643 10:128324887-128324909 ACTTACCAAGAAACAGAAGCAGG - Intergenic
1076909613 10:133380339-133380361 GGAGACCAGGAAGCTGAAGCTGG + Exonic
1077151636 11:1075474-1075496 GGTGACCAAGGCCCAGCAGAGGG + Intergenic
1077776774 11:5280806-5280828 GGTTACACAGAACCAGAAGGCGG + Intronic
1077842970 11:5994836-5994858 GGAGACTGAGAACTAGAAGCTGG - Intergenic
1078167899 11:8905999-8906021 GGTCACCTAGGACCAGAGGCAGG + Intronic
1078203139 11:9202733-9202755 TGTATTCAAGAACCAGAAGCTGG - Intronic
1079967993 11:27002356-27002378 GGTGGTCAAGAATCAGAAGGAGG - Intergenic
1080055516 11:27902545-27902567 GGTGACAAAGGAACAGATGCAGG - Intergenic
1082249151 11:49960517-49960539 GGTGGCCATGAATCAGCAGCTGG - Intergenic
1082561809 11:54627827-54627849 GGTGGCCATGAATCAGCAGCTGG + Intergenic
1084342506 11:68515398-68515420 TGGGACAAAGAACCAGGAGCTGG + Intronic
1084356798 11:68644256-68644278 TGGGACAAAGAACCAGGAGCTGG + Intergenic
1086855097 11:91856369-91856391 GGGAACCAAGAACCATGAGCAGG + Intergenic
1088059072 11:105623515-105623537 GGTGAACAAGACAAAGAAGCAGG - Intronic
1089566209 11:119373060-119373082 GGTGACCCTAACCCAGAAGCTGG - Exonic
1089719140 11:120395971-120395993 AGTAACCAAGATCCAGGAGCTGG - Intronic
1090131384 11:124145839-124145861 GGTGAGGAAAAACAAGAAGCAGG - Intronic
1090231987 11:125113872-125113894 GGTGACCAAGAGTCAGAGGCTGG + Intergenic
1090444363 11:126750679-126750701 GGTGTCAGGGAACCAGAAGCTGG - Intronic
1091168373 11:133500268-133500290 TGTGAGCAGGAACCAGGAGCCGG + Intronic
1092501124 12:9049221-9049243 TTTGACCAAGAACAAGCAGCTGG - Intergenic
1093363306 12:18259338-18259360 TGTGACCCAGACCCCGAAGCTGG - Intronic
1095969141 12:47889688-47889710 GGAGACCAAGAAATAGAAACTGG + Intronic
1096634450 12:52949476-52949498 GGAGACCGAGAACCGGAGGCTGG + Exonic
1097934722 12:65233415-65233437 GTAGACCCAGAACCAGATGCTGG - Intronic
1098911502 12:76213840-76213862 GGAGACCTAGAAGGAGAAGCTGG - Intergenic
1101024322 12:100585588-100585610 GGTGATGAACAACCTGAAGCTGG - Intronic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1102784678 12:115594779-115594801 GGTGACCCTCAACCAGTAGCAGG - Intergenic
1104286582 12:127430037-127430059 TGTGAGCAGGAAACAGAAGCAGG + Intergenic
1104716411 12:131019178-131019200 GGTGACCAAGGAGGAGCAGCAGG - Intronic
1104854781 12:131896447-131896469 GGGGACCAGGAACCTGAGGCGGG + Intronic
1105421751 13:20258572-20258594 GGTGACCCAGAACAGGAGGCTGG + Intergenic
1105704651 13:22961515-22961537 TGAGACCAAGAACCACAAGGAGG - Intergenic
1105857606 13:24386567-24386589 GGAGACCAAGAACCACAAGGAGG - Intergenic
1106023336 13:25934894-25934916 GGTGACTAAGGGCCAGGAGCTGG + Intronic
1106133683 13:26958853-26958875 GGGGACCAAGGACAAGCAGCTGG + Intergenic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1106684642 13:32045302-32045324 GGTGACGAAGATCCAGATGTGGG - Intronic
1107229136 13:38086880-38086902 GGTCACCAAGTACCAGCAGAAGG - Intergenic
1110098385 13:71561650-71561672 TGTAACAAAGAACCAGAAACTGG - Intronic
1114899348 14:27037428-27037450 GATGACCAAGAAACAGAAGGGGG - Intergenic
1115662712 14:35512762-35512784 GGAGACCAAGAAATGGAAGCTGG - Intergenic
1115802044 14:37005340-37005362 GGGAACCAAGAACCAAAAACAGG - Intronic
1117025277 14:51613254-51613276 GGTGACAAAGAAACACAAACAGG + Intronic
1117472421 14:56059394-56059416 GGTGACAAAGAAAAAGAAACTGG + Intergenic
1120079794 14:80202946-80202968 GGTGAAGAAGCACCAGAACCAGG - Exonic
1121398448 14:93649009-93649031 GGGGAGAAAGAACCAGAAGAGGG + Intronic
1125745939 15:41997159-41997181 GGTGGCCAAGGCCCTGAAGCAGG - Exonic
1125758429 15:42081514-42081536 GGTGGCCAAGGCCCTGAAGCAGG - Exonic
1125807061 15:42502707-42502729 GGGGCTCAAGAGCCAGAAGCTGG - Intronic
1126772268 15:52070278-52070300 GGTGAGAAAGGACCAGAAGCTGG - Intergenic
1127020207 15:54738240-54738262 GGTGATGTAGTACCAGAAGCAGG - Intergenic
1127364541 15:58275408-58275430 GGTAACCATTAACCGGAAGCTGG - Intronic
1129297104 15:74605545-74605567 GCTGGCAAAGCACCAGAAGCTGG + Intronic
1132789948 16:1680153-1680175 GGCCACCAGGAACCAGAAACCGG - Intronic
1133202703 16:4214012-4214034 GTTGACCCAGCCCCAGAAGCTGG - Intronic
1134628734 16:15741561-15741583 GGCGGCCAAGAAGCAGGAGCTGG - Exonic
1135472592 16:22744635-22744657 GTTGTCCAAGAACCAGCAGAAGG - Intergenic
1136086844 16:27891143-27891165 GGTGAATAAGTCCCAGAAGCTGG + Intronic
1136095399 16:27952029-27952051 GGGCACCAAGAAACAGGAGCAGG + Intronic
1136548574 16:30969345-30969367 GGGGACCAAGCCCCCGAAGCGGG + Exonic
1137782918 16:51113267-51113289 GATGACCTAGAAACAAAAGCAGG - Intergenic
1137881870 16:52057961-52057983 GGAGACCAAGAAGCAGAAATGGG - Intronic
1143111772 17:4556825-4556847 GGTGACCAACAACCAGAGAGGGG - Intergenic
1143982672 17:10883573-10883595 GGTGACCATGACCCAGGTGCCGG + Intergenic
1144955032 17:19014874-19014896 GGTGAGCAAGACCCAGAATGAGG - Intronic
1145871458 17:28277013-28277035 GGATACCAAGAACTGGAAGCTGG - Intergenic
1147217597 17:38909706-38909728 GATGAAAAAGAACCAGAACCAGG - Intronic
1148211091 17:45809143-45809165 GGTGAGCAAGGACCAGTAGGTGG + Intronic
1148808192 17:50274628-50274650 GGCGACCAGGCTCCAGAAGCAGG - Intronic
1149936305 17:60810468-60810490 GGAGACCGGAAACCAGAAGCTGG + Intronic
1151570991 17:74925215-74925237 GGAGAGCAGGAACCAGAAGATGG + Intronic
1152529507 17:80908958-80908980 CGTAACCGAGAACCAGCAGCTGG - Intronic
1153907894 18:9679210-9679232 GGAGACCAAGAACCGGAGGCTGG - Intergenic
1155941055 18:31802444-31802466 TGTGGCCAAGGAGCAGAAGCAGG - Intergenic
1156210652 18:34937677-34937699 GGGGTCCAAGATCCAGAAGCAGG - Intergenic
1159793367 18:72811861-72811883 GGTCTCCAAGAACCAAAAGAAGG - Intronic
1160845091 19:1162753-1162775 GGAGACCAGGAACCTGACGCTGG + Intronic
1160856822 19:1221520-1221542 GGTGAACAGGGCCCAGAAGCAGG - Intronic
1162300720 19:9843302-9843324 GAAGACCAAGATCCAGAAGGAGG - Intronic
1163287929 19:16360424-16360446 GGTCACCAAGAGCCAGAAACAGG + Intronic
1163827737 19:19533029-19533051 GGTGCCCAAGACCCAGGAGGTGG - Intronic
1163986823 19:20961389-20961411 GAGGACCAAGAACCGGAAGGTGG + Intergenic
1165378372 19:35460033-35460055 GGAGAGCAAGACCCATAAGCAGG + Intergenic
925118404 2:1399038-1399060 GGTCTCCAAGAAACAGAAGAGGG - Intronic
926124038 2:10260504-10260526 GGAGCCCAGGAACTAGAAGCCGG - Intergenic
926308726 2:11659232-11659254 GGTGACCAGGAACCACAGCCAGG - Intronic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
927427173 2:22994494-22994516 GGTGGGCAAGAAGCAGAACCAGG - Intergenic
928429449 2:31205606-31205628 GGTGAGAAAGAGACAGAAGCAGG + Intronic
931791363 2:65666770-65666792 GGATACCAAGAATCGGAAGCTGG + Intergenic
933889004 2:86748164-86748186 GGTTACCTAGCAACAGAAGCTGG + Intronic
933941612 2:87249693-87249715 TGTGACGAAGAAGCAGGAGCTGG + Intergenic
936092969 2:109512667-109512689 GCTGAGCAAGAAAGAGAAGCCGG + Intergenic
936338613 2:111611898-111611920 TGTGACGAAGAAGCAGGAGCTGG - Intergenic
942971406 2:181962154-181962176 GGAGACCAAGAACCGGAAGCTGG - Intronic
943414500 2:187584017-187584039 AGTAGCCAATAACCAGAAGCTGG + Intergenic
943548694 2:189312214-189312236 GGAGACCGAGAACAGGAAGCTGG - Intergenic
945335541 2:208588574-208588596 GGGGACAAACCACCAGAAGCGGG + Intronic
946969992 2:225080878-225080900 TTAGACCAAGAACCAGATGCAGG + Intergenic
948322537 2:237082249-237082271 GGTTTCCCAGAAGCAGAAGCCGG - Intergenic
1169639523 20:7734790-7734812 GTTGACCTAGAACCAGTAGGAGG + Intergenic
1171140116 20:22733765-22733787 GGAGACCAAGAACCAGAGGCTGG - Intergenic
1173408490 20:42788456-42788478 GGTGACCAAGAGCCAGAGGCAGG - Intronic
1173565348 20:44034632-44034654 GGTGACAGAGACCCAGAAGTTGG - Intronic
1173636908 20:44567664-44567686 GGTGCACAAGAAACACAAGCTGG - Intronic
1174349551 20:49957045-49957067 GGAGACCAAGAACTGGAAGCCGG + Intergenic
1176409045 21:6437814-6437836 AGAGACCAAGAACATGAAGCTGG + Intergenic
1177070470 21:16499373-16499395 AGTGACTAAGAACCAGATGATGG - Intergenic
1177972227 21:27804652-27804674 AGTGACCAAGGACCAGAGCCTGG - Intergenic
1178381664 21:32114811-32114833 GATGACCAAAACCCAGAAGCGGG - Intergenic
1178951642 21:36990350-36990372 GGTGGCCGAGAGGCAGAAGCTGG - Intergenic
1179344400 21:40543428-40543450 CATGACCCAGAACCAGAATCTGG + Intronic
1179684537 21:43046136-43046158 AGAGACCAAGAACATGAAGCTGG + Intergenic
1181001818 22:19991321-19991343 GGTGCCCAAGACCCCGAGGCAGG + Intronic
1181092507 22:20483781-20483803 GGAGACCGAGAACCGGAAGCTGG - Intronic
1182026443 22:27122973-27122995 GATGGCAAAGAACGAGAAGCTGG + Intergenic
1183382170 22:37495738-37495760 GGTGACGCAGAGCCAGGAGCTGG - Exonic
1184114770 22:42416034-42416056 GGTGTCCATGACCCAGAAGTAGG + Intronic
1184448315 22:44567262-44567284 GGAGACCAAGAACCGGAAGCTGG + Intergenic
951890465 3:27563511-27563533 GCTGTCTAAGAACCTGAAGCAGG - Intergenic
952347709 3:32503706-32503728 GGTGACCAAGAAAGAGAAAAAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953338810 3:42116873-42116895 GGTGACAAAGAACAAGAAAAGGG - Intronic
953412623 3:42698815-42698837 AGTGACCAAGCAGCAGCAGCAGG + Exonic
953493277 3:43366941-43366963 CGTGACCGAGAACCTGAAGGAGG - Exonic
954214587 3:49117226-49117248 GGAGGCCCGGAACCAGAAGCGGG - Exonic
954249353 3:49356205-49356227 GGTGCCCGAGAAGCAGCAGCTGG + Intergenic
954451909 3:50576227-50576249 GGTGGCCAAGAATCAGGAGCTGG - Intronic
955875981 3:63490710-63490732 GGTGCCCATGAACCAAAATCAGG - Intronic
958882105 3:99684040-99684062 AGTGTCCAAGAATCAGAACCTGG - Intronic
960322668 3:116255690-116255712 GGAGACCTAAAACCAGATGCTGG + Intronic
962701011 3:137999665-137999687 GGTGACAAGGAACCAGACTCAGG + Intronic
963089688 3:141471593-141471615 GAAGACAGAGAACCAGAAGCTGG - Intergenic
963123351 3:141794328-141794350 GGGGGCCAAGAACCTGAAGAGGG + Intronic
966595513 3:181721780-181721802 GGTACCCAAGAACCAGGAGTGGG - Intergenic
970015357 4:11506619-11506641 GGGGACCAAGAAACAGCAGGAGG - Intergenic
972538690 4:40020542-40020564 GGAGACCGAGAACTGGAAGCTGG + Intergenic
973147126 4:46841092-46841114 GGTAAGCAAGAACCAGAAGATGG + Intronic
973219478 4:47709018-47709040 GCTGAGCAAGAAACAGAAGAGGG + Intronic
973954369 4:56048908-56048930 GGTGCCCAGAAACCAGGAGCGGG - Intergenic
975711722 4:77167600-77167622 GGTCCACAAGAGCCAGAAGCTGG - Exonic
978152321 4:105451660-105451682 GGTGACCAAGAAGACCAAGCTGG + Intronic
978161435 4:105552801-105552823 GGTCACCAAGAAAAAGAATCTGG + Exonic
979962206 4:127034568-127034590 AGTGACAAAGATCCAGAAGTAGG + Intergenic
983338004 4:166420868-166420890 GCTGTCCAAGAACCAGGACCTGG + Intergenic
985510087 5:308522-308544 GGAGATCAAGAACCAAACGCAGG - Intronic
986308820 5:6536139-6536161 GGTCACCCACAACCAGAGGCAGG - Intergenic
987825605 5:23026748-23026770 GATGAGCAAGAAGCAGAAGGTGG - Intergenic
989012180 5:36885505-36885527 AGAGACCAAGAACCAGAGACTGG + Intronic
992933663 5:81678054-81678076 ACTGAACAAGAACCAGAACCAGG + Intronic
992968070 5:82024013-82024035 AATGACCAAGAACCAGAATAGGG + Intronic
993062033 5:83050166-83050188 GGTGACCCAGAAGGAGAAGCAGG + Intergenic
994214550 5:97123058-97123080 AGAGACAAAGAACCAGAAGAGGG - Intronic
995215313 5:109588607-109588629 GGAGACCGAGAACTGGAAGCTGG + Intergenic
996452024 5:123636412-123636434 GGAGACCGAGAACCGGAGGCTGG + Intergenic
998549871 5:143067045-143067067 CGACACCAAGAAGCAGAAGCGGG - Intronic
1001250251 5:170141620-170141642 GGAGACCGAGAACCAGAAGCTGG - Intergenic
1001516991 5:172362798-172362820 GGTAGCCAACTACCAGAAGCAGG - Exonic
1001548381 5:172584678-172584700 GGTCACAAAGAATAAGAAGCTGG + Intergenic
1005475050 6:26199612-26199634 GGTGACCAAGGCGCAGAAGAAGG + Exonic
1005480602 6:26251704-26251726 GGTGACCAAGGCGCAGAAGAAGG + Exonic
1005483060 6:26273029-26273051 GGTGACCAAGGCACAGAAGAAGG + Exonic
1005642296 6:27807831-27807853 GGTGACCAAGGCCCAGAAGAAGG - Exonic
1005703097 6:28423558-28423580 GATGGCAAAGAACCTGAAGCTGG + Intergenic
1005761251 6:28970093-28970115 GGAGACCAAGAACCGGAAGCTGG - Intergenic
1010312990 6:74409876-74409898 CATGACCAATAACCACAAGCTGG - Intergenic
1011053898 6:83185139-83185161 GGTGAACATGAGACAGAAGCAGG + Intronic
1013289532 6:108708453-108708475 GGTGAACAAGAACCACAAGAAGG + Intergenic
1013667365 6:112362405-112362427 GGAGACCGAGAACTGGAAGCTGG - Intergenic
1014009281 6:116458281-116458303 GGAGACCGAGAACTGGAAGCTGG - Intergenic
1014803309 6:125801518-125801540 CATGACAAAGTACCAGAAGCTGG + Intronic
1017889712 6:158628203-158628225 CGAGACCAAAAACCAGAAGCAGG + Intronic
1018199767 6:161383984-161384006 TGTGATCAGGAACCAGAAGCAGG + Intronic
1023278852 7:38548922-38548944 GGTAACAAAGAAACAGAAGATGG + Intronic
1026146999 7:67755184-67755206 ATTGGCTAAGAACCAGAAGCAGG + Intergenic
1026540366 7:71274977-71274999 GGTGACCCAGGGCCAGAGGCAGG - Intronic
1030815641 7:114033583-114033605 GGTGTCCAAGAAGCAGAAAAGGG + Intronic
1032614056 7:133446937-133446959 GGTGGCAAAGTATCAGAAGCAGG - Intronic
1033001550 7:137510700-137510722 GGTCACCAACAACTAGATGCTGG + Intronic
1034411789 7:150945919-150945941 GGGGACCTAGAAACAGAGGCAGG + Intronic
1036508498 8:9378851-9378873 CGTTACAAAAAACCAGAAGCTGG + Intergenic
1037517931 8:19652326-19652348 GGTGACCAAGATCAAGGAGGGGG + Intronic
1038972488 8:32651809-32651831 AGTTACCAAGAACTAGAAGAAGG - Intronic
1040639928 8:49321334-49321356 TTTGACCAAGAAGCATAAGCAGG + Intergenic
1040691278 8:49941593-49941615 GCTGCCCATGAACCTGAAGCAGG - Intronic
1046586313 8:116152789-116152811 GCTGACCAAGAAGAAAAAGCAGG - Intergenic
1048738593 8:137529729-137529751 GGAGAACAAAAACCAGAAGTTGG - Intergenic
1049060115 8:140270179-140270201 GATGACCAAGAAGCAGAGGAAGG + Intronic
1049157885 8:141078055-141078077 CATGACCAAGCACCACAAGCTGG + Intergenic
1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG + Intergenic
1050643038 9:7689158-7689180 TGTGACCAACAAGCAGAAGGGGG + Intergenic
1052611006 9:30773748-30773770 CGAGACCAAGAACCAGAGGGTGG + Intergenic
1053634265 9:39980195-39980217 GGTGAACAAGATCCAGACACAGG - Intergenic
1054209622 9:62270502-62270524 GGTGAACAAGATCCAGACACAGG + Intergenic
1055708882 9:79037374-79037396 GGAGACCAATAACTGGAAGCTGG - Intergenic
1057739508 9:97699223-97699245 GGAGGCCAAGAACTGGAAGCTGG + Intergenic
1057829438 9:98395579-98395601 GGTGACCAGGATGCAGGAGCAGG + Intronic
1058615882 9:106827386-106827408 TGAGACCAAGAACCCGGAGCTGG + Intergenic
1060348575 9:122837846-122837868 GGAGACTGAGAACCAGAGGCTGG + Intergenic
1060965697 9:127711283-127711305 GGTGACCACGAACCGGATGTGGG + Exonic
1061726893 9:132587071-132587093 GGGGAGAAAGAACCCGAAGCTGG - Intronic
1061825416 9:133255680-133255702 GGTGCCCAAGAACCACCAGGCGG - Exonic
1062533440 9:137011503-137011525 GGGGACCTCGAACCAGAAGGAGG + Exonic
1185622894 X:1464409-1464431 GGAGACCAAGCAGCAGATGCAGG - Exonic
1187197882 X:17105521-17105543 GGTGACTAAGCTCCAAAAGCAGG - Intronic
1187666534 X:21617369-21617391 GGTTACCAACTACCAGAAGATGG + Intronic
1196794236 X:119489537-119489559 GGTGTCCAGGAGCTAGAAGCAGG - Intergenic
1200085910 X:153605025-153605047 GGAGACTGAGAACCAGAAGCTGG - Intergenic
1200701583 Y:6407058-6407080 TGAGACCACGAACCACAAGCTGG + Intergenic
1200912757 Y:8545666-8545688 GGAGACCAAGACCCACAACCTGG - Intergenic
1201032528 Y:9757640-9757662 TGAGACCACGAACCACAAGCTGG - Intergenic
1201304796 Y:12541411-12541433 TGTCACCAAGAACCACAGGCAGG - Intergenic