ID: 1101473735

View in Genome Browser
Species Human (GRCh38)
Location 12:105023890-105023912
Sequence CATCACAGTGGGTTAAAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101473729_1101473735 17 Left 1101473729 12:105023850-105023872 CCTAGTAGGTACTCAAGATAATG 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1101473735 12:105023890-105023912 CATCACAGTGGGTTAAAAAATGG 0: 1
1: 0
2: 4
3: 16
4: 222
1101473728_1101473735 24 Left 1101473728 12:105023843-105023865 CCTGGTACCTAGTAGGTACTCAA 0: 1
1: 14
2: 162
3: 1095
4: 3910
Right 1101473735 12:105023890-105023912 CATCACAGTGGGTTAAAAAATGG 0: 1
1: 0
2: 4
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101473735 Original CRISPR CATCACAGTGGGTTAAAAAA TGG Exonic
903860901 1:26363964-26363986 CATCTCAGTGCGTTAGCAAAGGG - Intronic
904801387 1:33095121-33095143 CCTCACAGTGGGTAAGGAAAAGG - Intronic
906093001 1:43198755-43198777 AACTACAGTGGCTTAAAAAAAGG + Intronic
906872233 1:49495716-49495738 CTTCACATTGATTTAAAAAAAGG + Intronic
908132658 1:61090110-61090132 GTTAAGAGTGGGTTAAAAAAGGG - Intronic
908992002 1:70102779-70102801 CAGTACAATGGGTTAATAAATGG - Intronic
909549239 1:76879319-76879341 CAGCTCAGGGAGTTAAAAAAAGG - Intronic
910790045 1:91041704-91041726 CAGCTCAGGGAGTTAAAAAAAGG + Intergenic
912575282 1:110665360-110665382 CAACACAGTGGACTAAATAAGGG + Intergenic
917179693 1:172282710-172282732 CATCACAGTGGTTTAACAAAAGG - Intronic
918758192 1:188364637-188364659 AATCACAGTAGGTAAAACAAAGG - Intergenic
919410046 1:197231631-197231653 CATCCCAGAGGGTGAAATAAGGG + Intergenic
919636925 1:200012277-200012299 TAACACAGTTGGTTAAGAAATGG + Intergenic
921636832 1:217505483-217505505 CAACACTGTGGGTGAGAAAAGGG - Intronic
923797456 1:237171713-237171735 CAGTGCAGTGGGTTAGAAAAAGG + Intronic
923862101 1:237901642-237901664 GATAACAGTGGGGGAAAAAATGG + Intergenic
924637920 1:245806602-245806624 TTTCAAAGTGGGTTAAAAGAGGG + Intronic
1063075333 10:2710977-2710999 CATGAAAATGGGTTAAAACAAGG - Intergenic
1063364473 10:5481355-5481377 CAACACAAGGGGGTAAAAAAGGG - Intergenic
1063543221 10:6955463-6955485 CATCACTGTTAGTTAAAAGATGG + Intergenic
1063709445 10:8463220-8463242 CATCACAGGGAGATAAAAATTGG + Intergenic
1065257222 10:23882836-23882858 CATGAAAATGGGTTAAAAAATGG + Intronic
1065645257 10:27827195-27827217 TATCATAATGGGTTAAGAAAGGG - Intronic
1065686150 10:28286797-28286819 ACTCACAGTGGGAAAAAAAAAGG + Intronic
1066061610 10:31728423-31728445 AATCACAGTGGTGTAGAAAATGG - Intergenic
1067332868 10:45338069-45338091 CAGCTCAGGGAGTTAAAAAAAGG + Intergenic
1068246099 10:54371147-54371169 CATAATAATGGGTTACAAAATGG + Intronic
1068358624 10:55945509-55945531 AATCACAGTGTGTTTAAAAATGG + Intergenic
1071950444 10:90697472-90697494 CAACACGGTGGGACAAAAAATGG - Intergenic
1072311302 10:94157880-94157902 CATCACACTGAGATAAATAATGG - Intronic
1072530979 10:96318884-96318906 GATCACAGTGAGAGAAAAAAAGG - Intronic
1072938959 10:99741891-99741913 TATCTCAATGGTTTAAAAAAAGG - Intronic
1074366234 10:112859697-112859719 CATCACAGTGTGATAATATAAGG - Intergenic
1077155259 11:1088221-1088243 CATCACAGGGGCTCCAAAAAGGG - Intergenic
1077843282 11:5997872-5997894 CATCACAATGGCTTCAAAATTGG + Intergenic
1079046947 11:17113376-17113398 CATCACAGTGATTTAGAAGAAGG - Intronic
1079489410 11:20970834-20970856 TATCACAGTGGGTGCAAAACTGG + Intronic
1080372138 11:31662343-31662365 CATAAAAGTGGGTAAATAAAGGG + Intronic
1082666421 11:55981218-55981240 CATCACAGGGTGTAAAAACATGG - Intergenic
1086831142 11:91565320-91565342 CATCTCGGTGGGAAAAAAAATGG + Intergenic
1087951118 11:104221073-104221095 CATCACAATGGCTTAAAAAAGGG - Intergenic
1088691537 11:112332779-112332801 CATCAGAGTGGGATAGCAAATGG + Intergenic
1088824095 11:113479050-113479072 CTACAAAGTGGGTTAAGAAATGG - Intergenic
1089055417 11:115581077-115581099 GATCACAGTAGATTAAAAGAGGG - Intergenic
1089962961 11:122631924-122631946 CATCATGGTGGGTTAAAAAGAGG + Intergenic
1090281939 11:125463855-125463877 CCTGTCTGTGGGTTAAAAAACGG - Intronic
1090602180 11:128384635-128384657 CATCAGAGTGGATTACAGAAGGG - Intergenic
1090968204 11:131616612-131616634 CATCATCTTGGGTTAAAAACAGG - Intronic
1091117001 11:133022654-133022676 CATCATAGGGGGTTCAAAGATGG + Intronic
1091465377 12:679246-679268 CATCACAGTGGGTTACATTTTGG + Intergenic
1094102250 12:26777098-26777120 CAGCTCAGAGAGTTAAAAAAAGG + Intronic
1096455871 12:51785783-51785805 CATCACAGTGTATTAGAAATAGG - Intronic
1097673574 12:62571044-62571066 CATAACATCGGGTTAAGAAAAGG + Intronic
1098383464 12:69894399-69894421 AATAACAGTGGCTTTAAAAATGG - Intronic
1099526096 12:83720969-83720991 CAGCTCAGGGAGTTAAAAAAAGG + Intergenic
1099974918 12:89536400-89536422 AATCTCAGTGGCTTAAAATAAGG + Intergenic
1101473735 12:105023890-105023912 CATCACAGTGGGTTAAAAAATGG + Exonic
1103057565 12:117833786-117833808 CATCAAGGTGGGTTCAAAATAGG - Intronic
1103278734 12:119736358-119736380 AATCAAAGAGGGTTAAAATAGGG - Intronic
1104051575 12:125198093-125198115 CTTCATATTGGGTTAAAAGATGG + Intronic
1106135611 13:26971316-26971338 CATCACAGTGGGTTATGGAGAGG - Intergenic
1107176543 13:37406105-37406127 CATCACAGTGGAATAAGAATAGG - Intergenic
1108562840 13:51663510-51663532 CATCACAATTGGTTAGAAATTGG + Intronic
1109036122 13:57262802-57262824 CATCACAGAGTGATAAAAATGGG - Intergenic
1109075885 13:57833927-57833949 CAGCACTGTGGGTTAAAACTGGG - Intergenic
1109160472 13:58967469-58967491 GAACACAGTGGGTAAAAGAATGG - Intergenic
1111072879 13:83191871-83191893 CACTACAATGGCTTAAAAAATGG + Intergenic
1113112130 13:106834526-106834548 TATCACAGTGGGGTAATGAATGG + Intergenic
1113967539 13:114162707-114162729 CATCACACTGGTTTTGAAAAAGG - Intergenic
1114592722 14:23882244-23882266 CATCACAGTTGATTGACAAAAGG + Intergenic
1115064002 14:29232675-29232697 CATCATAGTGTGAAAAAAAAAGG - Intergenic
1117517445 14:56515922-56515944 CATCGCACTGGCTTAAAACAGGG - Intronic
1117647788 14:57870314-57870336 CAGCACAGTGGTTTAAAGCACGG + Intronic
1117948229 14:61054236-61054258 CATGACAGTGGTATAAAAACAGG - Intronic
1118178881 14:63470965-63470987 CTTCAGGGTGGGGTAAAAAATGG - Intronic
1118945781 14:70385801-70385823 TAACATAGTGGTTTAAAAAAAGG + Intronic
1124435901 15:29649157-29649179 CATCAGAGAGGCCTAAAAAAAGG + Intergenic
1125056522 15:35364670-35364692 AAACAAAGTGGGTTAAAAACAGG - Intronic
1125522158 15:40354378-40354400 CATGACAGTGGGAGGAAAAAGGG - Intronic
1127471381 15:59293666-59293688 CATCACAGTGAATTCAGAAAAGG + Intronic
1128867136 15:71122682-71122704 CATCATTGTGCTTTAAAAAATGG - Intronic
1129823309 15:78619056-78619078 TAACCCAGTGGGTTACAAAATGG + Intronic
1130643103 15:85698015-85698037 ACCCACAGTGGCTTAAAAAAAGG + Intronic
1130896961 15:88178485-88178507 CATCAGAGTGGGGTAAAAGATGG - Intronic
1134800055 16:17075815-17075837 CATTATAGCAGGTTAAAAAAAGG - Intergenic
1136055212 16:27683315-27683337 AATCAGAGTGGCTTAAACAATGG + Intronic
1137273274 16:46917034-46917056 CAACACAGAGGGGTAGAAAAGGG - Intronic
1140791609 16:78397380-78397402 TCTAAGAGTGGGTTAAAAAATGG + Intronic
1140807264 16:78544543-78544565 CATTGCAATGAGTTAAAAAATGG - Intronic
1141847165 16:86618703-86618725 CATCACAGTGGCTTAACAAAAGG - Intergenic
1144232852 17:13226393-13226415 CTTAAAAGTTGGTTAAAAAAAGG + Intergenic
1144992285 17:19241737-19241759 AATTACAGTGGTTTAAAAAAAGG - Intronic
1150990033 17:70246703-70246725 CAACACAACTGGTTAAAAAAGGG + Intergenic
1154407230 18:14104524-14104546 AACCACAGTGGGGAAAAAAAAGG + Intronic
1155699888 18:28731001-28731023 AATCATAGAGGGTTAAAATAAGG - Intergenic
1156436147 18:37132159-37132181 CATCACAGGGGCCTCAAAAATGG - Intronic
1156898992 18:42278551-42278573 CATCACATTTGGGTAAAAAATGG + Intergenic
1157845896 18:51003793-51003815 CAGCTCAGGGAGTTAAAAAAGGG + Intronic
1158852344 18:61507572-61507594 CATGAAAGTGGTTTAGAAAAAGG - Intronic
1158924411 18:62239109-62239131 CATCACATAGGTTTAAAGAAGGG - Intronic
1162242134 19:9363475-9363497 CATAACAGAGGGGAAAAAAAGGG - Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1168192177 19:54747062-54747084 CATCACATTGGCATAAAGAAAGG - Intronic
925261568 2:2533346-2533368 CAGCAGAGAGGGTTAACAAATGG - Intergenic
926437806 2:12855390-12855412 GATTACAGTGGGTAAAAAATGGG - Intergenic
928607959 2:32961642-32961664 CATCACAGTGCTTCACAAAAGGG + Intronic
929861112 2:45677944-45677966 CATCACAGTGGCAGACAAAAGGG - Intronic
931078922 2:58747248-58747270 AATCACAGCAGGTTAAAACAAGG - Intergenic
932044183 2:68330748-68330770 CATAAAAGTGGGTGAATAAAAGG - Intergenic
932855233 2:75226859-75226881 CATCCCAGTGGCTTAACTAATGG + Intergenic
933133711 2:78704221-78704243 CATGAAAGTGGATTAAACAATGG - Intergenic
942555410 2:177167743-177167765 CATCACAGGGGTTTCAGAAAAGG + Intergenic
942895620 2:181050014-181050036 CATCACAGTAATTTACAAAAAGG + Intronic
943696080 2:190933256-190933278 CATCACATTAGTTTTAAAAATGG - Intronic
945699988 2:213157369-213157391 CATGACTGTGGTTTAGAAAAAGG + Intergenic
945838999 2:214866368-214866390 CACAACTGTGAGTTAAAAAATGG + Intergenic
946051368 2:216865259-216865281 CATCCCAGGGTGTTAGAAAAGGG + Intergenic
947195899 2:227567431-227567453 CATAACAGTGGTTTAGTAAAGGG - Intergenic
1169280357 20:4262081-4262103 CTTCACAGTGGAATAAAAAAGGG + Intergenic
1170224080 20:13971909-13971931 CAGAACAGAGAGTTAAAAAATGG - Intronic
1170479783 20:16754419-16754441 CATCACAGTGGGCAAGAGAAAGG - Intronic
1171014479 20:21527657-21527679 CATCACAGTGGGTTCACCATAGG + Intergenic
1173855220 20:46246062-46246084 CATCCCAGGGGGCTGAAAAATGG + Intronic
1174219838 20:48945510-48945532 ATTCACAGTGGGTTGAAACAAGG - Intronic
1177188177 21:17820158-17820180 TATCACAGTTGGTTAGAAAAAGG + Intergenic
1178221326 21:30663491-30663513 CATCATAGTGGGTTGAATAGTGG + Intergenic
949123064 3:411357-411379 TAGCACAGTGGGGGAAAAAAGGG - Intergenic
949160808 3:879668-879690 CATCACTGTGGCTTAGAACAGGG - Intergenic
949488533 3:4564835-4564857 CAACACAGGAGTTTAAAAAAGGG + Intronic
951262868 3:20532460-20532482 AATCTCAGTGGCTTAAAACAAGG + Intergenic
953897678 3:46814671-46814693 CAGCTCAGTGAGTTAAAATAAGG - Intergenic
953948130 3:47165923-47165945 AATCACGGTGTGTAAAAAAATGG - Intergenic
954178531 3:48863346-48863368 CATGAGAGTTGGTTAAGAAAAGG + Intronic
954604776 3:51900850-51900872 CATAACACTGGCTTAAAGAAGGG - Intronic
956667730 3:71657963-71657985 CATGACAGTGGGAAAAAAATGGG - Intergenic
957891834 3:86369280-86369302 CATCATAGTGGTTCAAAGAAAGG - Intergenic
957920798 3:86745955-86745977 CACCTCAGAGAGTTAAAAAATGG + Intergenic
960227810 3:115187132-115187154 CATCAAACTTGTTTAAAAAAGGG + Intergenic
960382026 3:116974585-116974607 TATCACAGGGATTTAAAAAATGG + Intronic
961461740 3:127054481-127054503 CAACTCAGTAGGTTAGAAAAAGG - Intergenic
965255782 3:166408963-166408985 CATCTCATTGGGGGAAAAAAAGG - Intergenic
966002476 3:174967163-174967185 CATCAGAGAGCTTTAAAAAAGGG - Intronic
966810673 3:183841435-183841457 CATGACAAGGGGTTAAAGAAAGG - Intronic
970642506 4:18082727-18082749 CATCACAGTGACTTTAAAGAAGG + Intergenic
970870124 4:20807108-20807130 TTTCACAGTTGTTTAAAAAATGG - Intronic
971637927 4:29087332-29087354 CAGCACAGTCAATTAAAAAATGG + Intergenic
972823587 4:42730868-42730890 CATAACAGTAAGTTAAAACATGG - Intergenic
973749775 4:54003047-54003069 CACCACTGTGGGGAAAAAAAAGG + Intronic
974529415 4:63088748-63088770 CCTCACAGGGGGTTAAAAATGGG - Intergenic
977032650 4:91906102-91906124 CATTAAAGTGATTTAAAAAATGG - Intergenic
978933031 4:114339919-114339941 TATCACAATGGTTTATAAAAAGG - Intergenic
979766747 4:124472625-124472647 CAGCTCAGGGAGTTAAAAAAAGG + Intergenic
983481882 4:168284931-168284953 CATCACTGTGAGACAAAAAAAGG + Exonic
984218067 4:176939290-176939312 CAAAACAGTGAGTTGAAAAAAGG - Intergenic
986764413 5:10911823-10911845 GATCAGAGTGGGTTAAGAAAAGG + Intergenic
986775708 5:11012134-11012156 CATCACAGTGCTTTGTAAAATGG - Intronic
988863375 5:35307959-35307981 CATTGCAGTGGATTAAGAAAAGG + Intergenic
989348521 5:40457123-40457145 ACTAACAGTGTGTTAAAAAATGG - Intergenic
990819551 5:59822481-59822503 TATTACATTGGTTTAAAAAAGGG - Intronic
991160531 5:63494399-63494421 CATCACTGTGGAAAAAAAAATGG - Intergenic
991523198 5:67524352-67524374 CATCACATAGAGTAAAAAAATGG - Intergenic
994501678 5:100587238-100587260 AATCACAGTGGGTTGCAACAAGG + Intergenic
994982722 5:106897690-106897712 GATCAGAGTGGGTAAAAACAGGG + Intergenic
995000090 5:107116994-107117016 AATTTCAGTGGTTTAAAAAAAGG + Intergenic
995116622 5:108488050-108488072 CATCACAGTGGTTTCAAAACAGG - Intergenic
995273267 5:110247863-110247885 CTTCATAATGGGTTAGAAAAGGG + Intergenic
996165225 5:120214714-120214736 CAGCTCAGGGAGTTAAAAAAAGG - Intergenic
996658420 5:125969243-125969265 GTTCCCAGTGGGTCAAAAAAAGG - Intergenic
997411566 5:133695009-133695031 CAACACAGTGGCTGAAAACAAGG - Intergenic
998571810 5:143266771-143266793 CAGCACATTTGGTTAAAAAAAGG + Intergenic
1001758646 5:174189809-174189831 GGTCACAGTGAGTTAACAAATGG + Intronic
1001858884 5:175036035-175036057 CATCACTGAGGGTGACAAAAAGG + Intergenic
1003227772 6:4222100-4222122 CAGCACAGGTGGTTAAGAAAAGG - Intergenic
1005362184 6:25041479-25041501 TATTACAGTGGGGAAAAAAATGG - Intronic
1007026384 6:38579501-38579523 CATCACAGTGGCTGGAAGAAAGG + Intronic
1007137995 6:39541468-39541490 CATCACAGTGTGTGAACCAATGG - Intronic
1009059720 6:58384399-58384421 CATAACAGTGGGGGAAAAAGAGG + Intergenic
1009231192 6:61062995-61063017 CATAACAGTGGGGGAAAAAGAGG - Intergenic
1009818036 6:68761790-68761812 CATTACACTGTGTTCAAAAATGG + Intronic
1010656503 6:78517982-78518004 CTACAAAGTGGGTTAAACAAAGG + Intergenic
1010866670 6:80983961-80983983 CATCACACTGGCTTTAAGAAGGG + Intergenic
1011674187 6:89715340-89715362 CATCACAGTGGCTTAGATGAGGG - Intronic
1011893067 6:92191723-92191745 GACCACAGTGGGATAAAAACTGG - Intergenic
1012650747 6:101749582-101749604 TATCAATGAGGGTTAAAAAATGG + Intronic
1014417541 6:121201366-121201388 CATGACGGTGGGTTAGGAAATGG + Intronic
1017853887 6:158331842-158331864 CCACACAGTGGGTTAAACACAGG + Intronic
1018919936 6:168165360-168165382 CATGACAGCAGGTTAAAAGAGGG - Intergenic
1019167613 6:170108954-170108976 CACCACAGGGGGTTACAATAGGG - Intergenic
1020491111 7:8785508-8785530 CATTTCAGTGGGTTAAAAGCAGG + Intergenic
1020684121 7:11272534-11272556 CATCACAGTTAGTTAAATGAGGG - Intergenic
1020719417 7:11722548-11722570 AATCACAGTGGTTTGGAAAATGG - Intronic
1021937666 7:25646994-25647016 CCTCCCAGTGGGTTACAACAAGG + Intergenic
1022081565 7:27026987-27027009 CATCACTGTACTTTAAAAAATGG - Intergenic
1023180133 7:37474210-37474232 CATCACAATGTGATAGAAAAGGG - Intergenic
1023212213 7:37818649-37818671 CTTCAGAGTGAGTTAAAAACAGG + Intronic
1024027738 7:45427782-45427804 CAACTCAATGGATTAAAAAAAGG + Intergenic
1024484945 7:49907447-49907469 CATAACAGTAGGATAAAAATAGG + Intronic
1026726494 7:72873991-72874013 CATCACTGTGGGAAAAGAAAAGG - Intergenic
1027475958 7:78631516-78631538 CAAGAGAGTGGGTTGAAAAAGGG + Intronic
1028232889 7:88326686-88326708 CATAACAGTGGGTAAAAATATGG + Intergenic
1030439236 7:109565549-109565571 CAACACATTGGAATAAAAAATGG + Intergenic
1031545039 7:123041289-123041311 AATCACAGTGGTTTAGGAAATGG - Intergenic
1034855059 7:154537349-154537371 CAATACAGTGGGTGTAAAAATGG - Intronic
1036584458 8:10110373-10110395 CATCTTAGTGGGTAACAAAATGG - Intronic
1037104747 8:15093479-15093501 CATAACAGTTGCTTAGAAAAGGG + Intronic
1038661730 8:29503415-29503437 CATCACAGTGCTTTCAAAAAGGG + Intergenic
1040414733 8:47186324-47186346 CATCTCAGTGGCATACAAAAAGG - Intergenic
1041231968 8:55761840-55761862 CATCACAGTGGTTTCATAGAAGG - Intronic
1041797007 8:61755915-61755937 CTTCACAGTTGGTAAAAACAGGG + Intergenic
1045414979 8:101957052-101957074 CATCCCAGTGGGTTAATGACAGG - Intronic
1046310365 8:112428366-112428388 CATCACAGAGGGTAAAAACTTGG + Intronic
1050093689 9:2041612-2041634 CATGGCAGTGGGTTTTAAAAGGG + Intronic
1050328960 9:4525785-4525807 CATCACAGAGAGATAAAAAATGG + Intronic
1052246114 9:26337389-26337411 CATCACAGTGAGTTAAGGAAGGG + Intergenic
1052294268 9:26880133-26880155 CATCACAGTGGTTTCTTAAAAGG + Intronic
1052368355 9:27638657-27638679 CAGCTCAGGGAGTTAAAAAAAGG + Intergenic
1054625970 9:67398538-67398560 AAACACAGTGGTTTAAAACAGGG - Intergenic
1054741950 9:68815025-68815047 TATCACAGTGGGATAAAAAAGGG - Intronic
1056335402 9:85563782-85563804 CATCAGAGTGGTTTCAAAAGAGG + Intronic
1056828633 9:89895426-89895448 CATCAGAATGGGTCAAAATAGGG - Intergenic
1057539697 9:95955126-95955148 CATCACAGTGGTTTAACTATAGG - Intronic
1057902587 9:98961140-98961162 CATAAAAGTGGGTAAACAAATGG - Intronic
1059474725 9:114536193-114536215 CAACAAAGTGGGTCAAAAGAAGG + Intergenic
1059579679 9:115530852-115530874 CATCTCAGAGGGAGAAAAAAAGG - Intergenic
1187679030 X:21747751-21747773 ACTCACAGTGGGTTCAGAAAAGG - Intronic
1188157001 X:26752349-26752371 GATCACAATGGCTTAACAAAAGG - Intergenic
1188966760 X:36563126-36563148 CATCACTGTTGGGTTAAAAATGG + Intergenic
1191238883 X:58162889-58162911 GACTACAGTGGGCTAAAAAAGGG - Intergenic
1192036482 X:67568262-67568284 CAAAACAGTGGGTTGAAAGAGGG + Intronic
1193326608 X:80185313-80185335 CATCAGAATGGGCAAAAAAATGG - Intergenic
1193832667 X:86307941-86307963 CAGCTCAGGGAGTTAAAAAAAGG + Intronic
1194366202 X:93017527-93017549 CAACACAGTGGTTAACAAAATGG + Intergenic
1194513687 X:94824421-94824443 CAGCTCAGTGAGTTTAAAAAGGG - Intergenic
1194556193 X:95363360-95363382 AATCACAGTCAGTAAAAAAATGG - Intergenic
1195170658 X:102264876-102264898 CTTCACAGTGCTTTAAAAATAGG + Intergenic
1195188201 X:102422223-102422245 CTTCACAGTGCTTTAAAAATAGG - Intronic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1198450893 X:136766803-136766825 CATCACAGTAGTATTAAAAATGG + Intronic
1199412828 X:147544659-147544681 CATCAAAATTGGTTAAATAATGG + Intergenic
1199477552 X:148262573-148262595 CATCACAATGGGATCAAATAAGG - Intergenic
1200956374 Y:8951015-8951037 CATAAAATTGGATTAAAAAATGG + Intergenic
1201384751 Y:13426890-13426912 CAGCTCATTGGCTTAAAAAAAGG + Intronic
1201627905 Y:16035413-16035435 CAGCACTGTGGGTTAATTAATGG - Intergenic