ID: 1101477526

View in Genome Browser
Species Human (GRCh38)
Location 12:105064733-105064755
Sequence TTGACTCAGCCCAGGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101477526_1101477531 4 Left 1101477526 12:105064733-105064755 CCTGAGAGCCTGGGCTGAGTCAA 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1101477531 12:105064760-105064782 CCATGGATAGAAGACCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101477526 Original CRISPR TTGACTCAGCCCAGGCTCTC AGG (reversed) Intronic
901232429 1:7648711-7648733 TTGTCTCTGCTCAGGCTTTCTGG - Intronic
903121500 1:21219423-21219445 GTGCCTCAGCCCAGCCTCACAGG + Intronic
903424615 1:23244691-23244713 CTGTCTCAGCCAAGGCTCTAAGG + Intergenic
906681336 1:47727676-47727698 TAGACTTAGCCCAGGGTCTAGGG - Intergenic
906681402 1:47728141-47728163 TTTAGGCAGCCCAGGCTCCCTGG + Intergenic
906787658 1:48630014-48630036 TTAACTCATCTCAGGGTCTCTGG - Intronic
907159371 1:52359578-52359600 TTGTTTCAGCCCAGGCTCTTGGG - Intronic
907995274 1:59625031-59625053 TTTACACAGCCCTAGCTCTCAGG + Intronic
908814138 1:68014223-68014245 ATGGGTCAGGCCAGGCTCTCTGG + Intergenic
909339105 1:74511729-74511751 TTGACTCTTCTCAGGCTCACAGG - Intronic
911193923 1:94974882-94974904 TTGAGTCACTCCAGGCTTTCTGG - Exonic
912506251 1:110158527-110158549 TCAACTCAGGCCAGGCCCTCAGG - Intronic
912952933 1:114133052-114133074 TACCCTCAGTCCAGGCTCTCTGG + Intronic
914214066 1:145608339-145608361 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
914466010 1:147928742-147928764 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
916408567 1:164522210-164522232 GTGAGGCAGCCCAGGCTGTCAGG - Intergenic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
1066180423 10:32957360-32957382 TAGACACAGGCCGGGCTCTCAGG + Intronic
1066190583 10:33051957-33051979 AAGACTCAGGCCTGGCTCTCCGG + Intergenic
1071446627 10:85754983-85755005 TTGAATCAGCCTAGTCTTTCTGG + Intronic
1075388928 10:122078229-122078251 CTGACTCAGGCCAGACCCTCTGG - Intronic
1075723829 10:124601804-124601826 TTGCCTCAGGCCTGGCTCCCCGG + Intronic
1076352329 10:129825856-129825878 TGGACTCTGCCAGGGCTCTCTGG - Intergenic
1076601618 10:131660525-131660547 GTGTCTGAGCCCAGGCTCTAGGG + Intergenic
1077204756 11:1336893-1336915 TGGGCTCACCCCAGGCCCTCAGG + Intergenic
1077244920 11:1532077-1532099 CTGACTCAACCCAGATTCTCAGG + Intergenic
1078084137 11:8223777-8223799 TCGACTCAGCCCATGCAGTCTGG - Intergenic
1078579828 11:12530220-12530242 TTGTCTCAGCCCAGAATCCCAGG + Exonic
1078670962 11:13364661-13364683 TTCACACAGCCCAAGCTCTCAGG + Intronic
1081413843 11:42789698-42789720 TTGACTCAGGGCATGCTCTCAGG - Intergenic
1083428037 11:62599346-62599368 TTGCCTCAGCACAGGGTTTCCGG - Intronic
1083798539 11:65032641-65032663 ATGACTCTGCCCAGGGTTTCAGG - Intronic
1084497840 11:69515390-69515412 ATGACTCCGCCCATGCCCTCTGG + Intergenic
1089609846 11:119663138-119663160 TTAACTCACCCCAGGGTGTCAGG - Exonic
1092862878 12:12734825-12734847 TTTACTAAGGCCAGGCTCTGTGG + Intronic
1093351579 12:18108982-18109004 TTGACTCACCCCAGGTTTTGTGG - Intronic
1094145264 12:27222111-27222133 TTGACTTGGCCCAGGCTTGCTGG + Intergenic
1096003924 12:48153267-48153289 TTGACTCAACCCAAGATCACAGG - Intronic
1100790700 12:98126865-98126887 TGCTCTCTGCCCAGGCTCTCTGG + Intergenic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1101696386 12:107131277-107131299 TGGCCTCTGCCCAGGATCTCTGG - Intergenic
1103333781 12:120173780-120173802 CTGTCTCAGTCCTGGCTCTCTGG - Exonic
1103393644 12:120591657-120591679 TTAACTCAGCCCAGGTGGTCAGG + Intergenic
1104906299 12:132215236-132215258 GTGACACAGCCCAGGCTCTCAGG + Intronic
1105426157 13:20296712-20296734 AGGACTCAGCCCAGAGTCTCAGG - Intergenic
1107805338 13:44148582-44148604 TTTACTGAGCTCATGCTCTCAGG + Intronic
1113742375 13:112720475-112720497 TTGCCTCAACCCAGGCTCACGGG - Intronic
1113756167 13:112812518-112812540 TTCACTGAGCCCAGGCTGGCTGG - Intronic
1117013102 14:51490975-51490997 TTGACTAAGGGCAGGCTCTAAGG + Intronic
1117951971 14:61091782-61091804 TTGGCGCAGCCCTGGCTCTGTGG + Intergenic
1118606395 14:67507083-67507105 TATACTCAGCCCAGGAACTCAGG - Intronic
1118836550 14:69482423-69482445 TTGCCTCAGGCCTGGCTCCCTGG - Intergenic
1118846571 14:69551860-69551882 CTCACACAGCCCAGGGTCTCAGG + Intergenic
1120163613 14:81170719-81170741 CTGACTCAGCGCTGGCTCTTTGG - Intergenic
1121106593 14:91283771-91283793 TTGTCTCCTCCCAGCCTCTCAGG - Intronic
1122695980 14:103552325-103552347 TTGATTCCACCCGGGCTCTCAGG + Intergenic
1124497400 15:30194766-30194788 ATGACTCACCCAAGGTTCTCAGG + Intergenic
1124665978 15:31593302-31593324 GTGTCTCAGTCTAGGCTCTCTGG - Intronic
1124746173 15:32343881-32343903 ATGACTCACCCAAGGTTCTCAGG - Intergenic
1124848881 15:33316905-33316927 TGGGCTCACCCCAGGATCTCTGG + Intronic
1127008603 15:54597454-54597476 TTTACTTAGCCCAGGGTCTGTGG + Intronic
1127698336 15:61473277-61473299 TTGGCTCAGCCCAGATTCTAAGG - Intergenic
1127966201 15:63924647-63924669 TCGAATAAGCCCAGGCCCTCTGG + Intronic
1128591383 15:68900802-68900824 TTTCCTCAGCCCAGGCTCGAAGG - Intronic
1129387211 15:75202559-75202581 TGGCCTCAGCCCAGGCTGGCAGG + Intronic
1129794582 15:78366419-78366441 CTGTCACAGGCCAGGCTCTCTGG - Intergenic
1131378171 15:91942511-91942533 TTGACGATGCCCAGGCTCACTGG + Intronic
1132709359 16:1259579-1259601 TGGACACAGCCCAGGGCCTCAGG - Intergenic
1132799689 16:1745890-1745912 CTGCCTCTGCCCAGCCTCTCTGG - Intronic
1132800217 16:1748350-1748372 CTGGCTCAGCCCAGGCCCTGGGG + Intronic
1132881073 16:2161981-2162003 GTGACCCAGACTAGGCTCTCGGG - Intronic
1133118513 16:3592053-3592075 TTGAGTCAGCCCAGGCCAACGGG + Intronic
1133755133 16:8757045-8757067 TTGACTCAGCCCATGGGCGCTGG + Intronic
1135042429 16:19128129-19128151 TTGCTTCAGCCCAGGATTTCAGG - Intronic
1138184177 16:54963747-54963769 TTGACTTTGCCCAGGCTCAGAGG + Intergenic
1138585896 16:57970300-57970322 TTAGCTCAGCCCTGGCTCTCGGG - Intronic
1143121213 17:4608143-4608165 TTGGCTAAGCACAGGCTCTCGGG + Exonic
1144771163 17:17760436-17760458 TTGGCTCAGCCCAGTGTCCCTGG + Intronic
1146794849 17:35773748-35773770 CAGACTCAGCCCAGGCTGTGGGG - Intronic
1148126614 17:45240758-45240780 TGGATTCAGGCCAGGCTCTGGGG - Intronic
1148335400 17:46837623-46837645 TGGAGTCACCCCAGACTCTCTGG - Intronic
1148516905 17:48227768-48227790 TGGATTCAGAGCAGGCTCTCTGG - Intronic
1149409012 17:56384581-56384603 TTGTCTCAGCCCAAAATCTCAGG + Intronic
1149447206 17:56722690-56722712 TTCACTCAGTCCAGGCTGCCTGG + Intergenic
1151368182 17:73630574-73630596 TGGACTCAGCCTGGGCTCTAAGG + Intronic
1151402655 17:73865950-73865972 TTCACCCAGCCCAGGCCCTGGGG - Intergenic
1151446197 17:74165921-74165943 CTGACTCAACCCAGCCTCCCGGG - Intergenic
1152229107 17:79105863-79105885 GTGGCTCAGCCCAGGCTCCCAGG - Intronic
1152419471 17:80184358-80184380 GGGTCTCAGCCAAGGCTCTCGGG - Intronic
1152922663 17:83073658-83073680 ATGACTCAGCCCAGGCAGGCGGG - Intergenic
1153737746 18:8090092-8090114 TTGACACTCCCCAGGCCCTCTGG + Intronic
1157630739 18:49092858-49092880 ACCTCTCAGCCCAGGCTCTCTGG - Intronic
1158019356 18:52823179-52823201 TGGACTCAGGCCAGGCTTTGTGG + Intronic
1160287616 18:77559580-77559602 TGGACTCTGCCCAGTCTCTGAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162825562 19:13249438-13249460 TGGATTCAGCCCAGGATGTCAGG - Intronic
1163233827 19:16020028-16020050 TTGACTTTGCCCATCCTCTCTGG - Intergenic
1164538376 19:29103807-29103829 CTGACCTAGCCCAGACTCTCCGG - Intergenic
1166137524 19:40786415-40786437 CTGACTCAGCCCAGGAAGTCAGG + Intronic
1167634477 19:50646512-50646534 CTGACTCATCTCTGGCTCTCTGG - Intronic
926368005 2:12151263-12151285 GGGTCTCAGCCCAGGCCCTCTGG + Intergenic
927896630 2:26786655-26786677 GTGACTCTGCTCAAGCTCTCTGG - Intronic
928594731 2:32848931-32848953 TTGAATCAGCTCAGGCACTCTGG - Intergenic
930064945 2:47320746-47320768 TACCCTCAGCCCAGACTCTCCGG - Intergenic
930119779 2:47750994-47751016 TTGTCTCAGACCAGGTTCTGTGG - Intronic
932010314 2:67970973-67970995 TTAACTCAGCACAGGCTTTTTGG + Intergenic
933382922 2:81572760-81572782 GTGACTCAACCCAGTGTCTCTGG - Intergenic
934491208 2:94762929-94762951 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
934611748 2:95743493-95743515 TTGACTCAGGCCAGGCACAGTGG + Intergenic
936080656 2:109430416-109430438 TTGCCTCAGCCCAGGCTGTGTGG + Intronic
936675391 2:114708447-114708469 CTGGGTCAGCCAAGGCTCTCTGG + Intronic
937606255 2:123804801-123804823 TTGACTCACCTCAGGTGCTCAGG + Intergenic
937961493 2:127463649-127463671 CTCACTCAGCCCAGGCTTCCAGG + Intronic
940022258 2:149167725-149167747 TTGACTCACCCTAGGATTTCTGG + Intronic
948664163 2:239524067-239524089 CTGACTCAGCCCAGGGTTTATGG + Intergenic
1170408789 20:16066625-16066647 ATGCCTCAGCCCAGGCTTTCAGG - Intergenic
1171157305 20:22887831-22887853 TTGAGTCAGTCCAAGCTCTAAGG - Intergenic
1175257860 20:57657775-57657797 TTGGCTCAGCCCAGGGACTCTGG + Intronic
1175957822 20:62620758-62620780 TTGACTGAGCCCAGGCGTCCAGG + Intergenic
1179552982 21:42155006-42155028 TTGTCCCACCCCAGGCACTCAGG + Intergenic
1182429489 22:30291503-30291525 CAGGCTCAGCCCAGGCCCTCAGG - Intronic
949959607 3:9301257-9301279 GTGACTCAGGCCAGTCTATCTGG - Intronic
952790605 3:37197522-37197544 TTCAGTGTGCCCAGGCTCTCTGG - Intergenic
954211735 3:49101552-49101574 TGGACGCAGCCCAGGCACTCAGG + Intronic
958119435 3:89264716-89264738 TTGCCACATCCTAGGCTCTCAGG + Intronic
958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG + Intronic
962312900 3:134338467-134338489 TTGTCTCAGATCAGGCTTTCTGG + Intergenic
963790009 3:149574113-149574135 TTGCTTCAGCCCAGGATGTCGGG - Intronic
963929773 3:150991725-150991747 GTGCCTCAGCCCAGGCACTCAGG + Intergenic
964565464 3:158046541-158046563 TTAACTCAGGCCAGGCACACTGG + Intergenic
964697737 3:159528678-159528700 TTGACTCAGCTCAGGGTATGGGG - Intronic
965166118 3:165195973-165195995 GAGACTGAGCTCAGGCTCTCGGG - Exonic
968464150 4:742122-742144 CTCTCTCTGCCCAGGCTCTCGGG + Intronic
968464170 4:742186-742208 CTCTCTCTGCCCAGGCTCTCAGG + Intronic
973611727 4:52642112-52642134 GTGACTCAGCCCAAGATCTCAGG + Intronic
974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG + Intergenic
974832048 4:67201606-67201628 AAGACTCAGCCCTGACTCTCTGG + Intergenic
976353438 4:84086267-84086289 ATGACTTTGCCCAGGTTCTCAGG + Intergenic
979464122 4:121016830-121016852 ATGACACAGCTCAGTCTCTCAGG + Intergenic
981968511 4:150636010-150636032 TAGACTCAGACTAGGCACTCTGG + Intronic
984035331 4:174661027-174661049 TTGAGTCAGCCCTTTCTCTCAGG + Intronic
984548385 4:181133097-181133119 TTGGCCCAACTCAGGCTCTCAGG + Intergenic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
992748435 5:79840772-79840794 TTGACTCAGCCGGGGCTGTGTGG - Intergenic
994000175 5:94770287-94770309 GTGTGTCAGCCCTGGCTCTCGGG - Intronic
998603193 5:143605856-143605878 CTGACTGAGCACAGGCTCTTAGG - Intergenic
998760705 5:145428917-145428939 TTCACTCAGCCCAGCCACACTGG - Intergenic
1000042836 5:157498034-157498056 TTGACCCAGCACAGCCTCCCAGG + Intronic
1002443490 5:179276088-179276110 CTGACTCATCCCTGGGTCTCAGG + Intronic
1002471675 5:179439313-179439335 CTGGCTCAGCCCTGGCTCTTGGG - Intergenic
1008464750 6:51817857-51817879 TGCACTCTGCCCAGGCTGTCTGG - Intronic
1012689068 6:102291792-102291814 TTGACTGAGGTCATGCTCTCAGG - Intergenic
1015101117 6:129481883-129481905 CTGACTCATCCCATCCTCTCTGG + Intronic
1022459761 7:30594304-30594326 TAGAGTCACCCCAGGCTTTCTGG - Intergenic
1024854135 7:53757263-53757285 TTGGCTTAGCCTAGGCTCCCCGG - Intergenic
1031030081 7:116724810-116724832 AGGACTAAGCCTAGGCTCTCTGG - Intronic
1031401467 7:121329595-121329617 TTGGCGCAGCCCAGCTTCTCTGG - Exonic
1032784403 7:135188886-135188908 TTGCCCCAGCCCAGGCTCTGGGG + Intronic
1034255142 7:149720658-149720680 TGGGCTCAGGCCAGGCGCTCTGG - Intronic
1034307901 7:150060728-150060750 CTGAGTCAGCCCGGGCTCCCGGG - Intergenic
1034688524 7:152995296-152995318 TTGATTCAGCCCAGGAGTTCAGG - Intergenic
1034798952 7:154039941-154039963 CTGAGTCAGCCCGGGCTCCCGGG + Intronic
1037912951 8:22755006-22755028 AAGCCCCAGCCCAGGCTCTCAGG - Intronic
1039860446 8:41452941-41452963 TTGATTGAGCCCATGCCCTCGGG + Intergenic
1040105098 8:43537264-43537286 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1040105250 8:43537920-43537942 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
1040495954 8:47965863-47965885 AGGACTCAGTCCAGGCTGTCTGG + Intronic
1041152348 8:54948495-54948517 TTGACTCAGCACAGATTTTCCGG + Intergenic
1042771635 8:72388785-72388807 TTGGCTCAGCCCAGAAGCTCAGG - Intergenic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1045034527 8:98167108-98167130 ATGCCCCAGCCAAGGCTCTCAGG - Intergenic
1045649235 8:104327084-104327106 TTGACACAGCCCAGGCTTTGGGG + Intergenic
1047436018 8:124835909-124835931 ATGCCTCAGCCCAGCCTCCCTGG - Intergenic
1048013817 8:130480325-130480347 TAGACTCAGCCCCTGCCCTCGGG + Intergenic
1048982311 8:139709358-139709380 GTGACAAAGCCAAGGCTCTCTGG + Intergenic
1051421250 9:16891442-16891464 TTGACTCACCACAGCCTCCCGGG + Intergenic
1052880554 9:33598940-33598962 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1053277964 9:36797674-36797696 CTGACCCAGCCTCGGCTCTCAGG - Intergenic
1053916368 9:42947861-42947883 AGGTCTCAGTCCAGGCTCTCTGG + Intergenic
1053916517 9:42948509-42948531 GTGTCTCAGGCCAGGCTCCCTGG - Intergenic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1056585376 9:87924442-87924464 AGGTCTCAGGCCAGGCTCTCTGG + Intergenic
1056611504 9:88128498-88128520 AGGTCTCAGGCCAGGCTCTCTGG - Intergenic
1057911611 9:99024050-99024072 GGGATTCAGCACAGGCTCTCAGG - Intronic
1058667996 9:107337920-107337942 TGGCCTCAGCACAGGCTTTCTGG - Intergenic
1059330896 9:113535054-113535076 CAGACTAAGCCCATGCTCTCAGG - Intronic
1060375920 9:123115138-123115160 TTGACTCTGCTCATCCTCTCGGG + Intronic
1061661756 9:132134968-132134990 TGGACTGAGCCCAGCCTCCCTGG + Intergenic
1062150998 9:135018991-135019013 GGGCCTCAGCCCAGGATCTCTGG - Intergenic
1062475369 9:136724104-136724126 TCCACCCAGCCCAGGCACTCAGG + Intergenic
1187335332 X:18376595-18376617 TTGCCTCAGCGCAGCCTCCCAGG + Intergenic
1187470668 X:19566718-19566740 TTGCATCAGCCCAAGCTATCAGG + Intronic
1187871947 X:23771824-23771846 TAGTCTCAGCCCAGGTACTCAGG + Intergenic
1190265619 X:48826102-48826124 TTGAGGCAGCACAGGCTCTGTGG + Intergenic
1192213615 X:69142972-69142994 CTGCCTCAGCCCCGCCTCTCGGG - Intergenic
1192967865 X:76198685-76198707 TTGACTTAGCCAAGGATTTCAGG - Intergenic
1194655411 X:96567587-96567609 TTGAATCAGTCAAGGCCCTCAGG - Intergenic
1196185806 X:112743738-112743760 CTATTTCAGCCCAGGCTCTCAGG + Intergenic
1199678249 X:150205793-150205815 AAGGCTCAGCCCACGCTCTCAGG + Intergenic
1200642832 Y:5744039-5744061 TTGTCTCATCACATGCTCTCAGG + Intergenic