ID: 1101481932

View in Genome Browser
Species Human (GRCh38)
Location 12:105106975-105106997
Sequence CTCTTCAGTGATTCGTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101481931_1101481932 9 Left 1101481931 12:105106943-105106965 CCATTATAAATATATTTCATCTA 0: 1
1: 0
2: 4
3: 98
4: 1124
Right 1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101481932 Original CRISPR CTCTTCAGTGATTCGTAGTA TGG Intergenic
906738823 1:48160669-48160691 CTCTTCAGAGATTAGCAGTCAGG - Intergenic
908983688 1:69990265-69990287 CTCTTCAGTATTTCTTAGTTGGG + Intronic
908983825 1:69992351-69992373 CTCTTCAGTATTTCTTAGTTGGG + Intronic
909156906 1:72089877-72089899 CACTTCAGGGATTTGTGGTACGG + Intronic
910364579 1:86450889-86450911 ATCCTCAGTGATTCATGGTAGGG + Intronic
912176065 1:107158733-107158755 CTCTATAGTGATTCGTATGAAGG + Intronic
920185621 1:204157355-204157377 CTCTGCAGAGATTCCGAGTAAGG - Exonic
1064751048 10:18529398-18529420 CTCTTCACTGATTCGCCTTATGG - Intronic
1067482271 10:46610060-46610082 CCCTTCAATGATTCGTTGAATGG - Intergenic
1067612478 10:47731608-47731630 CCCTTCAATGATTCGTTGAATGG + Intergenic
1071627898 10:87191855-87191877 CCCTTCAATGATTCGTTGAATGG + Intergenic
1074042701 10:109808180-109808202 CTCTTCATTGAGTAGAAGTATGG + Intergenic
1074424871 10:113342075-113342097 CACTTCAGAGATTCATACTAAGG + Intergenic
1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG + Intronic
1079041560 11:17064562-17064584 CTCTTCTGTGATTCTAAGTCAGG + Intergenic
1079613418 11:22461241-22461263 CTTTTCTGTGATTCCCAGTAGGG - Intergenic
1089288264 11:117421465-117421487 CTCTTTGGTGATTCGTGGGAAGG - Intergenic
1089755635 11:120684398-120684420 CCATTCAGTTATTCATAGTATGG + Intronic
1090172931 11:124620683-124620705 CTATTCAGTGATTAGCTGTAAGG - Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103089681 12:118088846-118088868 CTGTGCTGTGATTCATAGTATGG - Intronic
1103289984 12:119837639-119837661 CTCTTCAGAGATGCCCAGTAAGG + Intronic
1110540600 13:76702651-76702673 ATATGCAGAGATTCGTAGTAGGG + Intergenic
1112854127 13:103745538-103745560 CTCTTCAGTGATAGTTAGTCTGG - Intergenic
1118453354 14:65924087-65924109 CTCCTAAGTGATTCGTAGGAGGG - Intergenic
1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG + Intergenic
1124470187 15:29977263-29977285 TTCTTCACTCATTGGTAGTAAGG - Intergenic
1129565999 15:76624636-76624658 TTCCTCAGTGATTTATAGTAGGG + Intronic
1130041347 15:80407290-80407312 CTCTTCTGTGATGTGTAGTGGGG + Intronic
1139874871 16:70137697-70137719 CTCTTGAGTGATTTGTAGAATGG + Intronic
1140360915 16:74343445-74343467 CTCTTGAGTGATTTGTAGAATGG - Intergenic
1150411497 17:64946673-64946695 CTCTTCAGTGATTCTAAACAGGG - Intergenic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1162637678 19:11983141-11983163 CTGTTCAGTGATTTGGAATATGG + Intergenic
1162673177 19:12275871-12275893 CTGTTCAGTGATTTGAAATATGG - Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
938942765 2:136183377-136183399 CTCTTTAGAGATTCATAGAACGG + Intergenic
939878936 2:147608287-147608309 CTTTTCAGTCATTCATAGTTAGG - Intergenic
941075735 2:161004419-161004441 CTCTTCAGTGATTCTCTCTAAGG + Intergenic
946536282 2:220632987-220633009 CTCTTCAATCATTCATAGAATGG - Intergenic
946843709 2:223840774-223840796 CTCTTCGGTGATTTGGGGTATGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1169184344 20:3601522-3601544 ATCTTCAGTGAATCACAGTAAGG - Intronic
1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG + Intergenic
1170924036 20:20706410-20706432 CTCTTCAGGCAGTCTTAGTATGG - Intronic
957436199 3:80180095-80180117 CTCTTAAGTGGTTAGTAGGAAGG + Intergenic
957457893 3:80476317-80476339 CTCTTCACTGTTTCACAGTATGG + Intergenic
972848470 4:43018893-43018915 CTCTTCATTTATTGGTAGTTGGG - Intronic
976741013 4:88357662-88357684 CTTTTCAGTCATTCGTGGTATGG - Intergenic
980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG + Intergenic
981558812 4:146024675-146024697 TTCTTCAGTGATTTGTACCATGG + Intergenic
983381482 4:167000285-167000307 CTCTGCAGTTATTCCTGGTAAGG + Intronic
986717874 5:10537279-10537301 CTCTTCAGTGAGCAGTAGCAGGG - Intergenic
986860914 5:11925754-11925776 CTCATCTGTGATTCTTACTAGGG - Intergenic
990083539 5:51945808-51945830 TTCTTCAGAGATTGGTAGGATGG - Intergenic
993707018 5:91182694-91182716 CTCCTCAGAGATTCGCAGAAAGG + Intergenic
999232699 5:150070901-150070923 CACTTCAGGGATTTGTAGCAGGG - Intronic
999780210 5:154843097-154843119 CTCTTCAGTGTTTGTTAGGAAGG + Intronic
1007842123 6:44725192-44725214 CTCTTCAGTGACTCGCATCATGG + Intergenic
1009577058 6:65478726-65478748 CTCTTCAGTGATTCTAAACAGGG - Intronic
1016529649 6:145043463-145043485 GTCTTCAGGGATTCACAGTAGGG - Intergenic
1022769945 7:33459086-33459108 CTCTTCAGTAATTGGCAATAAGG - Intronic
1027699937 7:81457201-81457223 CTCTTGAGTGATGCCTAGTCAGG + Intergenic
1031009663 7:116512759-116512781 CTCTACAGTGATTAGGAGTGTGG - Intergenic
1035608161 8:942927-942949 CTCTCCAGTGATGCGTTGCAAGG + Intergenic
1036040073 8:5067932-5067954 CTTTTAAGTGCTTCGTACTATGG - Intergenic
1041892041 8:62879974-62879996 CTCTTCATTGCTTCCTAATAAGG - Intronic
1056568434 9:87795459-87795481 CTCTTCTGTGGTTCGATGTAGGG + Intergenic
1188334780 X:28917546-28917568 TGATTCAGTGATTCTTAGTAGGG + Intronic
1193058362 X:77178308-77178330 CCCTTTAGTGATTAGTAGAAAGG - Intergenic
1195047618 X:101068239-101068261 CTCTTCAGTGGTTCTCAGAATGG - Intergenic
1199703597 X:150404855-150404877 CTATTCAGTAATTTGTAGAAAGG - Intronic