ID: 1101481932

View in Genome Browser
Species Human (GRCh38)
Location 12:105106975-105106997
Sequence CTCTTCAGTGATTCGTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101481931_1101481932 9 Left 1101481931 12:105106943-105106965 CCATTATAAATATATTTCATCTA 0: 1
1: 0
2: 4
3: 98
4: 1124
Right 1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101481932 Original CRISPR CTCTTCAGTGATTCGTAGTA TGG Intergenic