ID: 1101481932 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:105106975-105106997 |
Sequence | CTCTTCAGTGATTCGTAGTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 72 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 67} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101481931_1101481932 | 9 | Left | 1101481931 | 12:105106943-105106965 | CCATTATAAATATATTTCATCTA | 0: 1 1: 0 2: 4 3: 98 4: 1124 |
||
Right | 1101481932 | 12:105106975-105106997 | CTCTTCAGTGATTCGTAGTATGG | 0: 1 1: 0 2: 0 3: 4 4: 67 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101481932 | Original CRISPR | CTCTTCAGTGATTCGTAGTA TGG | Intergenic | ||