ID: 1101481963

View in Genome Browser
Species Human (GRCh38)
Location 12:105107337-105107359
Sequence CTCCTACGGTGGCGACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101481959_1101481963 8 Left 1101481959 12:105107306-105107328 CCGTACAGAATGTGCGGGAGAGC 0: 1
1: 0
2: 1
3: 2
4: 51
Right 1101481963 12:105107337-105107359 CTCCTACGGTGGCGACAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101481963 Original CRISPR CTCCTACGGTGGCGACAGAG AGG Intronic
900474587 1:2870179-2870201 CTTCTACGGGGGCCACAGCGAGG - Intergenic
901510296 1:9715143-9715165 CTCCAACCTGGGCGACAGAGTGG + Intronic
914986589 1:152462619-152462641 CTCCAGCGTGGGCGACAGAGTGG - Intergenic
919230731 1:194769874-194769896 CTCCAACCTGGGCGACAGAGTGG + Intergenic
921243353 1:213209736-213209758 CTCCTACTCTGCCTACAGAGTGG - Intronic
923982796 1:239344249-239344271 CTCCAGCCTTGGCGACAGAGTGG + Intergenic
1063188823 10:3674162-3674184 CTCCAACCTGGGCGACAGAGTGG + Intergenic
1066111625 10:32202410-32202432 CTCCAACCTGGGCGACAGAGTGG - Intergenic
1069449030 10:68501217-68501239 CTCCAACCTGGGCGACAGAGAGG + Intronic
1070627546 10:78061974-78061996 CTCCCACGGCAGCCACAGAGTGG + Intergenic
1073396732 10:103224105-103224127 CTCCAACCTAGGCGACAGAGTGG - Intergenic
1076592255 10:131591656-131591678 CTCACACGGTGGAGACAGAGAGG - Intergenic
1077178104 11:1199678-1199700 CTCGTCCTGTGCCGACAGAGGGG - Intronic
1077273681 11:1693608-1693630 CTGCTACCGTGGGGACAGAAAGG + Intergenic
1077833030 11:5896387-5896409 CTCCAACCTGGGCGACAGAGTGG + Intronic
1077916578 11:6615540-6615562 CTCCCACTGTGGTGACATAGGGG + Exonic
1078259428 11:9690933-9690955 CTCCAACCTTGGTGACAGAGGGG - Intronic
1083282793 11:61637804-61637826 CTCCCACGGTTGTGACAGTGGGG + Intergenic
1084513619 11:69622426-69622448 CTCCTGCCTGGGCGACAGAGTGG - Intergenic
1087533491 11:99413585-99413607 CTCCAACGTGGGCAACAGAGAGG + Intronic
1099826401 12:87782240-87782262 CTCCAACCTGGGCGACAGAGCGG - Intergenic
1101481963 12:105107337-105107359 CTCCTACGGTGGCGACAGAGAGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1128768739 15:70266532-70266554 CTGCTGCGGTGGAGACAGGGAGG - Intergenic
1130631499 15:85573511-85573533 CTCCAGCCTTGGCGACAGAGCGG + Intronic
1132785524 16:1655199-1655221 ATCCTACGGAGACGACAGACAGG - Exonic
1133943509 16:10329548-10329570 CTCCAACCTGGGCGACAGAGTGG + Intronic
1136466828 16:30450079-30450101 CTCCAACCTGGGCGACAGAGTGG - Intergenic
1137574664 16:49590864-49590886 CTCCTTCTCTGGAGACAGAGTGG - Intronic
1141222723 16:82086362-82086384 CACATACGGTGGGGAGAGAGAGG + Intronic
1141502744 16:84455052-84455074 CTGCTACTGTGGAGATAGAGGGG + Intronic
1144051940 17:11504417-11504439 CTCCTACGATCAGGACAGAGAGG - Intronic
1144638041 17:16923501-16923523 CTCCCAGGGTGACCACAGAGGGG - Intergenic
1146652213 17:34613806-34613828 CTCCTACAGTCACGCCAGAGAGG - Intronic
1148065580 17:44867073-44867095 CTCCCACCTGGGCGACAGAGTGG + Intronic
1148207221 17:45786669-45786691 CTCCAACCTGGGCGACAGAGTGG - Intronic
1156373861 18:36494972-36494994 CTCCAGCCTTGGCGACAGAGCGG - Intronic
1157176781 18:45459229-45459251 GTCTTAGGGTGGAGACAGAGAGG + Intronic
1161190549 19:2952560-2952582 CTCCAGCGTTGGCAACAGAGTGG - Intergenic
1163322300 19:16581880-16581902 CTCACACGGTGGGGACAGAAAGG - Intronic
1163716447 19:18875202-18875224 CTCCAGCGTGGGCGACAGAGTGG + Intronic
1164519958 19:28971583-28971605 CTCCAACTGGGGCAACAGAGTGG - Intergenic
1165850892 19:38849807-38849829 CTACTACGGCGGCGGCAGTGAGG - Exonic
1167602319 19:50461522-50461544 CTCCTAGTGTGGGGACAGGGAGG - Exonic
934064784 2:88330760-88330782 CTCCAACATGGGCGACAGAGTGG - Intergenic
935268186 2:101412171-101412193 CTCCTATGATGGCTACAGGGAGG - Intronic
943801690 2:192067839-192067861 CTACTACCGTGGTGACAGAATGG - Intronic
947619306 2:231578454-231578476 GTCCTACAGTGGCGGCAGACAGG - Intergenic
1171191614 20:23163110-23163132 CTCCTACACCGGGGACAGAGAGG + Intergenic
1175887437 20:62300463-62300485 CTCCAGCTGTGGCCACAGAGTGG - Intergenic
1181817718 22:25451148-25451170 CTCCAACCTGGGCGACAGAGCGG - Intergenic
1181925868 22:26358058-26358080 CTCCTACGGTGGCCACAGTCTGG - Intronic
1184020074 22:41814863-41814885 CTCCCACGGAGGTGACACAGAGG + Intronic
954256880 3:49413161-49413183 CTCCTGTGCTGGTGACAGAGAGG + Intronic
955351509 3:58196761-58196783 CTCCTTCAATGGGGACAGAGGGG - Intronic
964819637 3:160755781-160755803 CCCCTTCGGCGGCGACCGAGGGG + Intronic
969053955 4:4390264-4390286 CTCCTGCGGTGGAGAGGGAGGGG - Intronic
969866088 4:10077924-10077946 GTCCTACGGCAGGGACAGAGAGG + Exonic
970614754 4:17758646-17758668 CTCCTACGGTGAAGAAAAAGAGG + Intronic
998207208 5:140166430-140166452 CTCCTAGGGTGCAGACAGGGAGG + Intergenic
998494547 5:142576259-142576281 CTCCAGCCTTGGCGACAGAGCGG + Intergenic
999640520 5:153668015-153668037 CTCCTACAGTGGATATAGAGAGG + Intronic
999640540 5:153668150-153668172 CTCCTACAGTGGATATAGAGAGG + Intronic
1004314961 6:14578723-14578745 CTCCTAGGGTTGCGGCAGAAAGG + Intergenic
1010370963 6:75106931-75106953 CTCCTACCTGGGCAACAGAGTGG - Intronic
1011277341 6:85643451-85643473 CTCCGACGGTGGCGGCCGAGGGG + Intronic
1020145645 7:5640345-5640367 CTACTACGCTGGGGAGAGAGAGG - Intronic
1027334779 7:77138069-77138091 CTCGTATGGTGGAGATAGAGAGG + Intronic
1029781022 7:102733033-102733055 CTCATATGGTGGAGATAGAGAGG - Intergenic
1032725074 7:134583189-134583211 CTCCTGCCTGGGCGACAGAGTGG + Intergenic
1042613621 8:70625123-70625145 CTCCTACCTGGGCAACAGAGTGG - Intronic
1042678583 8:71352253-71352275 CTCCTCTAGTGGTGACAGAGAGG + Intronic
1043809354 8:84717153-84717175 CTCCAACCTGGGCGACAGAGCGG + Intronic
1046799411 8:118408928-118408950 CTCCAACCTGGGCGACAGAGTGG - Intronic
1047275147 8:123400130-123400152 CTCCAGCCTTGGCGACAGAGTGG + Intronic
1047757351 8:127928757-127928779 CTGCTGCGGTGGCTGCAGAGAGG + Intergenic
1049257067 8:141619831-141619853 CTCCTTCTGTGGCGCCACAGTGG - Intergenic
1051530464 9:18096479-18096501 CTCCTACTCTGGCCACAGAGTGG - Intergenic
1056382429 9:86067278-86067300 CTCCTAAGGAGGGCACAGAGTGG - Intronic
1057030961 9:91774989-91775011 CTCTTACGGTGGAGAGACAGAGG - Intronic
1185517266 X:709575-709597 CTCCAGCCTTGGCGACAGAGTGG + Intergenic
1185551405 X:985106-985128 CTCCTGCCTGGGCGACAGAGCGG + Intergenic
1187886392 X:23892734-23892756 CTCCAACCTGGGCGACAGAGCGG + Intronic
1188902658 X:35753133-35753155 TACCTACGGTGCTGACAGAGAGG + Intergenic
1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG + Intergenic