ID: 1101482118

View in Genome Browser
Species Human (GRCh38)
Location 12:105108035-105108057
Sequence GGTCCCAGCCACGGCGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101482107_1101482118 26 Left 1101482107 12:105107986-105108008 CCTTGGGGTGTGCGAGGGACGCG 0: 1
1: 0
2: 0
3: 11
4: 295
Right 1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 118
1101482106_1101482118 27 Left 1101482106 12:105107985-105108007 CCCTTGGGGTGTGCGAGGGACGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 118
1101482112_1101482118 -1 Left 1101482112 12:105108013-105108035 CCAGCGTTACTTTCGGGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101482118 Original CRISPR GGTCCCAGCCACGGCGGGTC AGG Intronic
900156858 1:1206630-1206652 GGTCCCAGCCACCTCCGGGCAGG - Intronic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
900221093 1:1509595-1509617 GGTGCCTGCCACGGCAGGGCCGG + Intergenic
900266537 1:1759992-1760014 GGACAGAGCCACGGCGGGGCCGG + Intronic
900397044 1:2457322-2457344 GGTCCCAGCCATGGCTGGAAAGG - Intronic
900491589 1:2951990-2952012 GGTCCCAGCAACGGCGCAGCTGG + Intergenic
900547321 1:3236193-3236215 GGTCACAGCCAGGGCAGGCCAGG + Intronic
902551255 1:17220947-17220969 GCTCCCAGCCACAGCTGGTTGGG - Intronic
902798070 1:18812312-18812334 GGTCCCAGCCTGGGAGTGTCAGG + Intergenic
903497345 1:23778525-23778547 GGTCACAGCCACGGCGGGGGTGG + Exonic
905890096 1:41513390-41513412 GGTCCCAGCCAGGGGAGGCCCGG + Exonic
906812264 1:48839968-48839990 GGTCCCAGCCTTGGTGGGTCAGG + Intronic
906913701 1:49983909-49983931 GTTCCCAGCCATGACGGGACAGG + Intronic
911904347 1:103548028-103548050 TGTCCCAGCCACGGCAGCTGTGG - Intronic
916072354 1:161177570-161177592 GGTCCCAGACACCGCGTGGCCGG + Exonic
1063392836 10:5661326-5661348 GGCCCCAGGCTCGGCGGGGCGGG - Intronic
1066370473 10:34815040-34815062 GGTCCCGGCCTCGGCTGCTCCGG - Exonic
1069942423 10:71964645-71964667 GACCCCAGCCGCGGAGGGTCGGG + Exonic
1069949121 10:72007402-72007424 GGGCCCCGCCACGGCCGGTCTGG - Exonic
1073137663 10:101228831-101228853 GGTCCCGGCCGGGGCGGCTCGGG + Exonic
1076852055 10:133098113-133098135 GGCCACAGCCTGGGCGGGTCGGG + Intronic
1076881253 10:133240223-133240245 GGTCCCAGCGAAGGCCGGCCTGG - Exonic
1077087933 11:763928-763950 GCTCTCAGCCAAGGCGGGTGAGG + Exonic
1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG + Intronic
1077247501 11:1546752-1546774 GGCCCCAGCCTCGGCGGGCGCGG + Intergenic
1077432793 11:2524315-2524337 GACCCCAGCCATGCCGGGTCAGG + Intronic
1077458846 11:2698850-2698872 GGTCCCAGTCAGTCCGGGTCTGG - Intronic
1081549133 11:44096001-44096023 TGTCACAGCCCCGGCGGGGCTGG - Intronic
1083610170 11:64000631-64000653 GGGCCCAGGCAGGGCGGCTCCGG + Intronic
1084041555 11:66545861-66545883 GGTCCCAGCGGCGGCGGCCCGGG + Exonic
1085831232 11:79903081-79903103 GGTCACAGCCAAGTGGGGTCGGG - Intergenic
1089242976 11:117097992-117098014 GGAGCCAGCCGCGGCGGGGCGGG - Intronic
1090784061 11:130032989-130033011 GGCCCCAGCCACAGTGGGGCTGG - Intergenic
1094411119 12:30169838-30169860 CGTCCCAGCCAAGGCGCGGCGGG + Intergenic
1101482118 12:105108035-105108057 GGTCCCAGCCACGGCGGGTCAGG + Intronic
1104792627 12:131493440-131493462 GGTCCCAGCCAGGGGTGGGCGGG - Intergenic
1105278456 13:18949537-18949559 GCACCCAGCCACGGGGGGACGGG + Intergenic
1105492583 13:20902863-20902885 CGTCGCGGCCTCGGCGGGTCTGG + Intronic
1107380827 13:39855134-39855156 GTTCCCAGCCACGGTGGGATGGG + Intergenic
1112771700 13:102800092-102800114 GCTCCGAGCCAAGGCGGGCCTGG + Intronic
1120951357 14:90044995-90045017 GGTCCCACCCACGTTGGGGCAGG + Intergenic
1125550200 15:40539217-40539239 GGTAACAGCCAGGGCGGGCCAGG - Intronic
1127916767 15:63461273-63461295 GGGCCCAGCCCCAGCGGGTCAGG + Intergenic
1128089180 15:64907327-64907349 GCTCCCAGCCAAGTGGGGTCAGG - Intronic
1129178411 15:73856515-73856537 GGTCCCAGCCAGGTTGAGTCTGG - Intergenic
1131111415 15:89767299-89767321 GGTCCCAGCCCCAGGGGGCCAGG - Intronic
1132346951 15:101114276-101114298 GCTCCCAGCAAAGGAGGGTCAGG + Intergenic
1132657266 16:1046578-1046600 GCCCCCAGCCACGGCGGAGCAGG + Intergenic
1132987495 16:2775463-2775485 GGCCCCAGCCACAGTGGGGCTGG - Exonic
1136176862 16:28523061-28523083 GGTTTCAGCCACCGAGGGTCTGG - Intergenic
1136531874 16:30875330-30875352 GGTCTCAGCCTCGGCGGGTCGGG + Intronic
1142136101 16:88452774-88452796 GGACCCAACCAGGTCGGGTCAGG + Intergenic
1144548128 17:16215952-16215974 GCTCCCAGCCACGAGGGGACCGG - Intronic
1144847140 17:18225833-18225855 GGTCGGAGCCACGTCGGGCCCGG + Intronic
1151655969 17:75496169-75496191 GGTCCCAGCCAGGGCGAGGTCGG - Intronic
1152665353 17:81565461-81565483 GGCCCCAGCCACGGGGTGCCGGG + Intronic
1152905840 17:82970542-82970564 GGTCGCGGCCACGCCGGGTGCGG - Intronic
1152905847 17:82970566-82970588 GGTCGCGGCCACGCCGGGTGCGG - Intronic
1152905854 17:82970590-82970612 GGTCGCGGCCACGCCGGGTGCGG - Intronic
1152905861 17:82970614-82970636 GGTCGCGGCCACGCCGGGTGGGG - Intronic
1154074152 18:11182771-11182793 GGTCCCAGCCAAGGGAGGGCAGG + Intergenic
1156481820 18:37441156-37441178 TCTCCCAGCCACGGAGGGTGGGG + Intronic
1160410257 18:78670949-78670971 CGTCCCTGCCACAGCGGGTTTGG - Intergenic
1160431101 18:78813249-78813271 GGTCGCAGGCCCGGCAGGTCGGG - Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162742703 19:12782707-12782729 GGTCCCGGCCGGGGCGGGGCTGG - Intronic
1165006912 19:32814845-32814867 GGCCCCAGCCAGGGCAGGCCTGG + Intronic
925032471 2:661442-661464 GGGCCCAGCCTCGGCAGCTCCGG - Intergenic
927935021 2:27071548-27071570 GGCCACGGCCACGGCGGGGCTGG + Intronic
937047292 2:118858598-118858620 GTTCCCCGCCAGGGTGGGTCAGG + Intergenic
938343359 2:130549646-130549668 GGGCCCAGCCAGGCCAGGTCTGG - Intronic
938346474 2:130571076-130571098 GGGCCCAGCCAGGCCAGGTCTGG + Intronic
939363991 2:141209203-141209225 GGTCCCTCCCACGACGGGTGGGG - Intronic
941111768 2:161424243-161424265 GGTCCGGGCCGCGGCGGGGCCGG - Exonic
946193508 2:218020188-218020210 GGACCCAGCCATGGCGGCTGTGG + Intergenic
948830517 2:240596356-240596378 GGTGCCAGCCACGGGGGGCATGG - Exonic
1169717011 20:8631170-8631192 GGCCCCAGCCCCAGCAGGTCTGG + Intronic
1170623637 20:18014138-18014160 GGTCCCAGCCATGGTGGGGCAGG + Intronic
1172587047 20:36092475-36092497 GGCCCCAGCTCCGGCGGCTCCGG + Intronic
1174177957 20:48656936-48656958 GGTCCCAGCCACGGGGGACCAGG + Intronic
1175852981 20:62103860-62103882 AGGCCCAGCCACGTGGGGTCTGG + Intergenic
1175926304 20:62473255-62473277 GGTGCCCGCCCCGGTGGGTCAGG - Intronic
1175961269 20:62637742-62637764 GGTCTGTGCCTCGGCGGGTCCGG + Intergenic
1177525692 21:22287571-22287593 TGTCCCAGCCACGCCAGTTCTGG + Intergenic
1177881032 21:26695245-26695267 GCTCCCAGCCACGGACAGTCTGG + Intergenic
1180027008 21:45171306-45171328 GGTCCCAGCAAGGGAGGTTCAGG - Intronic
1180055393 21:45356386-45356408 GGTCCCAGCCCCGGCAGCTCAGG - Intergenic
1182273935 22:29172698-29172720 GGTCCCAGCAATGGCTGCTCTGG - Intergenic
1182401330 22:30080119-30080141 GGTCCTAACCTCGGCGGGGCAGG + Intergenic
1183322772 22:37175357-37175379 AGTCCCAGGCAGGGCGGCTCAGG - Intergenic
1183530978 22:38353261-38353283 GGTCCCAGCCTGGGCTGGACCGG - Intronic
952934294 3:38383655-38383677 GGTCCCAGCTACTGGGGGTGGGG + Intronic
954115658 3:48465713-48465735 GATCCCAGCCACTCAGGGTCCGG - Exonic
954384356 3:50236543-50236565 GGTCCCAGACAGCCCGGGTCTGG - Intronic
954443489 3:50534366-50534388 GGTCACAGCCAGGGCTGGGCAGG - Intergenic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
961334052 3:126159687-126159709 AGTCCCAGCCAGGCCTGGTCTGG + Intronic
962345743 3:134618045-134618067 AGACGCAGCCACGGTGGGTCAGG - Intronic
964223006 3:154368016-154368038 GTTCCCAGCCCTGGAGGGTCGGG - Intronic
968494159 4:906384-906406 GGTGCCAGCCATGGCAGGACGGG - Intronic
968569132 4:1330182-1330204 GGTCCCAGCCGCCTGGGGTCAGG - Intronic
976732961 4:88283228-88283250 GGTCCCAGCCCCGGAGGCTGAGG - Intronic
986013292 5:3736561-3736583 GGTTCCAGTCACAGAGGGTCAGG + Intergenic
992269639 5:75052502-75052524 GGTGCCTACCACAGCGGGTCGGG - Intergenic
1001384168 5:171324703-171324725 GGTCCCTCCCAGGGCGGGCCGGG - Intergenic
1010462095 6:76125143-76125165 GTTCCCAGCCATAACGGGTCTGG + Intergenic
1019367740 7:643942-643964 GGTCCCAGACATCGCGGGGCAGG + Intronic
1021699016 7:23299661-23299683 GGTCCCAGCCAAGGTGGCTCTGG + Intronic
1024790843 7:52963521-52963543 GTTCCCAGCCATGACGGGACAGG - Intergenic
1030597990 7:111562317-111562339 GGCCCCGGCCCCGGCGGGGCGGG - Intronic
1033660725 7:143399939-143399961 GGTAGAGGCCACGGCGGGTCAGG + Exonic
1034513035 7:151551820-151551842 GGTCCCAGCCACGCCGGAGTCGG - Intergenic
1035228126 7:157444708-157444730 GGACCCAGTCAGAGCGGGTCAGG - Intergenic
1035277384 7:157755958-157755980 GTTCCCAGCCAGGGCTGGGCGGG + Intronic
1038760913 8:30384164-30384186 GGTCCAGGCCCCGGCGGGGCAGG + Intergenic
1041552630 8:59118920-59118942 GGTCCCAGACAGGGAGCGTCGGG + Exonic
1048497122 8:134944599-134944621 GATCCCAGCCACGGCAAGACTGG + Intergenic
1057354130 9:94321131-94321153 GGTTCAAGCCTCGGCGGGGCTGG + Exonic
1057653636 9:96936504-96936526 GGTTCAAGCCTCGGCGGGGCTGG - Exonic
1060534757 9:124375939-124375961 TGTCCCTGCCACGGGGGCTCAGG - Intronic
1061472050 9:130835004-130835026 CGTCCCAGCCCCGGCGGGGAGGG - Intronic
1061670379 9:132185106-132185128 GGCCCCAACCAAGGCGGGGCAGG + Intronic
1061934583 9:133850265-133850287 GGTCCCAGACCCGGAGGCTCAGG - Intronic
1062503349 9:136860677-136860699 TGTCCCAGCCTGGGCGGGGCAGG - Exonic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1193462951 X:81811583-81811605 ATTCCCAGCCCCGGAGGGTCGGG + Intergenic
1200147670 X:153934978-153935000 GGTCCCAGCCCCGGCCGTCCCGG - Exonic
1201750248 Y:17423596-17423618 GTTCCCAGCCTCGGAGGGTTGGG + Intergenic