ID: 1101486190

View in Genome Browser
Species Human (GRCh38)
Location 12:105163479-105163501
Sequence CACTTCAACTGCTAAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101486190_1101486196 27 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486196 12:105163529-105163551 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
1101486190_1101486191 -1 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486191 12:105163501-105163523 GTTTTTTTCCTTTCTTTTTGAGG 0: 1
1: 1
2: 49
3: 787
4: 11326
1101486190_1101486192 3 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486192 12:105163505-105163527 TTTTCCTTTCTTTTTGAGGCAGG 0: 1
1: 11
2: 188
3: 2372
4: 20583
1101486190_1101486195 23 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486195 12:105163525-105163547 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503
1101486190_1101486193 4 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486193 12:105163506-105163528 TTTCCTTTCTTTTTGAGGCAGGG 0: 1
1: 18
2: 227
3: 2604
4: 21277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101486190 Original CRISPR CACTTCAACTGCTAAAAAGA TGG (reversed) Intronic