ID: 1101486194

View in Genome Browser
Species Human (GRCh38)
Location 12:105163509-105163531
Sequence AGACCCTGCCTCAAAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2283
Summary {0: 2, 1: 25, 2: 221, 3: 693, 4: 1342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101486194_1101486197 7 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486197 12:105163539-105163561 TCACCCAGGCTGGAGTGCAGTGG 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
1101486194_1101486200 18 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486200 12:105163550-105163572 GGAGTGCAGTGGTGCAGTCATGG 0: 303
1: 3521
2: 21138
3: 61762
4: 120272
1101486194_1101486196 -3 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486196 12:105163529-105163551 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
1101486194_1101486195 -7 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486195 12:105163525-105163547 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101486194 Original CRISPR AGACCCTGCCTCAAAAAGAA AGG (reversed) Intronic