ID: 1101486195

View in Genome Browser
Species Human (GRCh38)
Location 12:105163525-105163547
Sequence AGGGTCTTGCTCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385038
Summary {0: 4209, 1: 20933, 2: 63781, 3: 122612, 4: 173503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101486190_1101486195 23 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486195 12:105163525-105163547 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503
1101486194_1101486195 -7 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486195 12:105163525-105163547 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101486195 Original CRISPR AGGGTCTTGCTCTGTCACCC AGG Intronic