ID: 1101486196

View in Genome Browser
Species Human (GRCh38)
Location 12:105163529-105163551
Sequence TCTTGCTCTGTCACCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549577
Summary {0: 26457, 1: 73050, 2: 147182, 3: 159645, 4: 143243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101486190_1101486196 27 Left 1101486190 12:105163479-105163501 CCATCTTTTTAGCAGTTGAAGTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1101486196 12:105163529-105163551 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243
1101486194_1101486196 -3 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486196 12:105163529-105163551 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101486196 Original CRISPR TCTTGCTCTGTCACCCAGGC TGG Intronic