ID: 1101486197

View in Genome Browser
Species Human (GRCh38)
Location 12:105163539-105163561
Sequence TCACCCAGGCTGGAGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 755785
Summary {0: 81688, 1: 171766, 2: 204013, 3: 179579, 4: 118739}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101486194_1101486197 7 Left 1101486194 12:105163509-105163531 CCTTTCTTTTTGAGGCAGGGTCT 0: 2
1: 25
2: 221
3: 693
4: 1342
Right 1101486197 12:105163539-105163561 TCACCCAGGCTGGAGTGCAGTGG 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101486197 Original CRISPR TCACCCAGGCTGGAGTGCAG TGG Intronic