ID: 1101486200 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:105163550-105163572 |
Sequence | GGAGTGCAGTGGTGCAGTCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 206996 | |||
Summary | {0: 303, 1: 3521, 2: 21138, 3: 61762, 4: 120272} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101486194_1101486200 | 18 | Left | 1101486194 | 12:105163509-105163531 | CCTTTCTTTTTGAGGCAGGGTCT | 0: 2 1: 25 2: 221 3: 693 4: 1342 |
||
Right | 1101486200 | 12:105163550-105163572 | GGAGTGCAGTGGTGCAGTCATGG | 0: 303 1: 3521 2: 21138 3: 61762 4: 120272 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101486200 | Original CRISPR | GGAGTGCAGTGGTGCAGTCA TGG | Intronic | ||