ID: 1101489007

View in Genome Browser
Species Human (GRCh38)
Location 12:105194837-105194859
Sequence CTGTATGTTCAGATAAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101489007 Original CRISPR CTGTATGTTCAGATAAGGCG TGG Intronic
910832865 1:91478097-91478119 TTGTATGTTTAGTAAAGGCGGGG - Intergenic
912422923 1:109558248-109558270 TTGTATTTTCAGAAAAGACGGGG - Intronic
916524733 1:165598743-165598765 TTGTAGGTTCAGGGAAGGCGTGG + Intergenic
918548840 1:185716694-185716716 CTGTATGTGCACATAATGCTAGG + Intergenic
919541806 1:198856585-198856607 TTGTATGTTTAGAAAAGGAGAGG + Intergenic
920385554 1:205568643-205568665 CTGTATCTCCGGATAAGGCTAGG - Intergenic
1069577817 10:69543450-69543472 CTATTTGTTGAGATAAGGTGTGG + Intergenic
1074073554 10:110098801-110098823 TTGTATTTTCAGTAAAGGCGGGG + Intronic
1087268500 11:96086818-96086840 CTGTGGATTCAGATAAGGCAAGG + Intronic
1088330178 11:108643151-108643173 TTGTATTTTCAGAAGAGGCGAGG - Intergenic
1100451457 12:94710921-94710943 CTGTATCTACAGAGAAGGGGAGG + Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1104765914 12:131330143-131330165 GTATATGTTCAGATAAGTGGAGG - Intergenic
1108333966 13:49419795-49419817 CTCTTTGTTCAGATTTGGCGGGG - Intronic
1109076943 13:57847546-57847568 CTGTATTTTCAAATAATGCCAGG - Intergenic
1110255547 13:73429881-73429903 CTGCATGTTCAGACAAGGAGTGG - Intergenic
1110981665 13:81908203-81908225 ATGTACATTCAGATAAGGTGGGG - Intergenic
1115549026 14:34488520-34488542 TTGTATTTTTAGAAAAGGCGAGG - Intergenic
1116805885 14:49493794-49493816 CTGTATGTTCAGGTAACACAGGG + Intergenic
1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG + Intergenic
1128764947 15:70245641-70245663 CTGTATGTTTCTATAAGGAGAGG + Intergenic
1138345699 16:56318875-56318897 CTGTTTGTGCAGATAAAACGGGG - Intronic
1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG + Intergenic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1145768677 17:27477046-27477068 CTGTATGGTCTGAAAAGGTGAGG - Intronic
1156534562 18:37850080-37850102 CTGTATCTTCAGTTAGGGGGAGG - Intergenic
1157980110 18:52369935-52369957 CTGTATGTTTGGATAAGATGAGG - Intronic
1162648294 19:12065805-12065827 CTGTATTTTCAGTAAAGACGGGG + Intronic
930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG + Intergenic
931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG + Intergenic
934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG + Intergenic
934938946 2:98485942-98485964 CTGCTTGTTCAAATAAGGGGAGG + Intronic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
939916862 2:148055874-148055896 CTGTAAGTTTAGATAAGTCTTGG + Intronic
941470833 2:165884970-165884992 TTGTATTTTCAGTTGAGGCGAGG - Intronic
942581465 2:177423455-177423477 CTGTATGGTTATAGAAGGCGAGG - Intronic
948307980 2:236963865-236963887 CTGCATTCTCAGCTAAGGCGAGG + Intergenic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1173380819 20:42539183-42539205 CTGTATCTCCAGACTAGGCGTGG + Intronic
1175027601 20:55919103-55919125 CTATATGGTCAGAAAAGGGGAGG + Intergenic
1179245687 21:39632342-39632364 TGGTATGTTCAGATAAGCAGTGG + Intronic
949267525 3:2175775-2175797 CTGTATGATCAGATCAGGTTAGG - Intronic
958428385 3:94007075-94007097 GTTTAGGCTCAGATAAGGCGCGG - Intronic
962369542 3:134809737-134809759 CTGCATGCTCAGATAAGGCAGGG - Intronic
967061880 3:185879962-185879984 CTGTGTGTCCAGATAAGAAGGGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
972333812 4:38087667-38087689 CTGTATTTTCAGTTGAGACGGGG - Intronic
976393065 4:84525685-84525707 CTGTATGTTTAGTTAAGACGGGG - Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
982694462 4:158583662-158583684 CTGTATTTTCAGAAAAGCCTAGG - Intronic
984077111 4:175196981-175197003 CTGTATTTTCAGTCAAGACGGGG - Intergenic
984427772 4:179609536-179609558 CTGTATTTTCAGTTGAGACGAGG - Intergenic
984430895 4:179647672-179647694 CAGTATGTTTAAATAAGTCGTGG + Intergenic
987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG + Intergenic
992596153 5:78349255-78349277 CTCTCTGTTCACATAAGGCAGGG + Intergenic
1008539861 6:52537258-52537280 CTGTATATTCGGATAGGGCTTGG - Intronic
1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG + Intronic
1018800201 6:167216305-167216327 ATGTAAGTTCAGATAAGTCATGG + Intergenic
1018812898 6:167310201-167310223 ATGTAAGTTCAGATAAGTCATGG - Intronic
1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG + Intronic
1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG + Intronic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1029799254 7:102929103-102929125 CTGTGTGTTGAGGTAAGGAGTGG + Intronic
1039110895 8:34039790-34039812 CTGAATGTTCACAAAAGGCCAGG - Intergenic
1042505429 8:69554803-69554825 CTGTATTTTCAGTAAAGACGGGG - Intronic
1045216480 8:100154114-100154136 CTGTATTTTCATATAATGCTTGG + Intergenic
1047022631 8:120792265-120792287 CTGTATGTTCTCATAAGTGGGGG + Intronic
1047326789 8:123846899-123846921 CTGTATTTTTAGAGAAGACGGGG - Intergenic
1047327429 8:123853325-123853347 CTGTATTTTTAGAGAAGACGGGG + Intronic
1049364009 8:142227647-142227669 CTGTGTGTTCACATTAGGCAGGG - Intronic
1052042802 9:23758729-23758751 CTCTATGATCAAATAAGGCCGGG + Intronic
1053803172 9:41776846-41776868 TTGTTTGGTCAGGTAAGGCGGGG + Intergenic
1054191464 9:61988156-61988178 TTGTTTGGTCAGGTAAGGCGGGG + Intergenic
1054646905 9:67599556-67599578 TTGTTTGGTCAGGTAAGGCGGGG - Intergenic
1055456293 9:76475070-76475092 CAGTATGTTCAGAGAAAGCCGGG - Intronic
1055891798 9:81131535-81131557 CCCTATGTTCAGATAAGGAATGG + Intergenic
1056062036 9:82893501-82893523 CTGTATGTTTAGATAATCCCTGG - Intergenic
1193972453 X:88072041-88072063 TTGTATTTTCAGTAAAGGCGAGG + Intergenic
1196250871 X:113458740-113458762 CTGTATCTTCAGATAGTGGGAGG + Intergenic
1199532136 X:148861784-148861806 ATGTATTTTCAGATGTGGCGGGG - Intronic