ID: 1101490436

View in Genome Browser
Species Human (GRCh38)
Location 12:105204886-105204908
Sequence GACCTCCAGTGTTACATTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101490436_1101490439 30 Left 1101490436 12:105204886-105204908 CCGTCAATGTAACACTGGAGGTC 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1101490439 12:105204939-105204961 ATTACAGAGCCTCAGTTTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101490436 Original CRISPR GACCTCCAGTGTTACATTGA CGG (reversed) Intronic
901042370 1:6372889-6372911 TACCTCTAGTGTTCCAGTGAAGG - Intronic
906804190 1:48764186-48764208 GCCTTCCAGGGTTACACTGACGG - Intronic
907353343 1:53851684-53851706 GACCTCAAGTTTTTCCTTGATGG - Intergenic
907664823 1:56425487-56425509 GAGCTCCATTTTTCCATTGAAGG - Intergenic
909557358 1:76968942-76968964 GAAATCCACTGTTACACTGATGG + Intronic
910160892 1:84271113-84271135 CACCTCCACTGTTGCAATGAAGG - Intergenic
911763880 1:101649800-101649822 GACTTCCAGTACTATATTGAGGG + Intergenic
912451003 1:109767765-109767787 GAACTCCTGTGTGTCATTGAAGG - Intronic
1064706860 10:18081918-18081940 GAGCTCCAGTTTTAGGTTGAGGG - Intergenic
1068481101 10:57589398-57589420 GACTTCCAGTACTACGTTGAAGG - Intergenic
1070049014 10:72868583-72868605 CACCTTCAGTGTTAAACTGAAGG - Intronic
1070778435 10:79123779-79123801 GACTTCCAGGGTTACATAGGCGG + Intronic
1072007905 10:91272910-91272932 TACCTCCAGTGTTACAGTTTTGG + Intronic
1073589660 10:104744522-104744544 TATCTCCACTGTTACAATGAAGG + Intronic
1076090845 10:127684320-127684342 CACCTCCAGCGTTGCCTTGAGGG + Intergenic
1079388540 11:20001463-20001485 GAACTCCAGTTTTAGATGGATGG + Intronic
1082058599 11:47841590-47841612 GACAGCCAGTGTTACAAGGAAGG + Intronic
1085829767 11:79886894-79886916 GACCTCCAGTGTTAATTTGAAGG + Intergenic
1087154385 11:94886386-94886408 GACATCCATTGTTGCATTGCGGG + Intergenic
1089598184 11:119595752-119595774 GACCTACCTTGTTAGATTGAAGG - Intergenic
1098001179 12:65945068-65945090 GAGCTCCAGTTTTTCGTTGAGGG + Intronic
1101490436 12:105204886-105204908 GACCTCCAGTGTTACATTGACGG - Intronic
1102363459 12:112310151-112310173 TACCTCAAGGGTTACAGTGATGG + Intronic
1109502197 13:63252542-63252564 GACCTCCAGTGAAATATTTAAGG + Intergenic
1111495227 13:89039328-89039350 GAGCTCCAATGTTACAAAGAAGG - Intergenic
1115172464 14:30524955-30524977 CTCCTCCAGTGTTCCATTGCAGG + Intergenic
1117472381 14:56059057-56059079 GACCTCCTGTGTGACACTAAAGG + Intergenic
1118120435 14:62834324-62834346 GAACTCCAGAATTACATTCACGG + Intronic
1122018858 14:98819952-98819974 GACCACCTGGGTTACATGGATGG - Intergenic
1128862057 15:71082475-71082497 GACTTCCAGTCTTACCTAGAAGG - Intergenic
1129335483 15:74849928-74849950 GGCCTCCAGTGGTACAGGGATGG + Intronic
1130314976 15:82787384-82787406 GACTTCCAGAGTTACAATGGAGG - Exonic
1133446811 16:5868272-5868294 GACGTCCAGTGTTGCATTATTGG + Intergenic
1133617411 16:7490953-7490975 GATCTCCAGTGTTAGATTTTAGG - Intronic
1135917546 16:26619060-26619082 GACTTCCAGTGCTATGTTGAAGG + Intergenic
1138809927 16:60137939-60137961 GACCTCCACTGTTAGTCTGATGG + Intergenic
1144638765 17:16926425-16926447 CTCCTCCAGTGTTTCCTTGATGG - Intergenic
1145208156 17:20995529-20995551 CTCCTCCAGTGTTTCATTGATGG + Intergenic
1146605864 17:34257207-34257229 GACTTCCAGTGTTTTCTTGAAGG + Intergenic
1147464131 17:40597745-40597767 GACCTGGAGTGTGACATAGAAGG - Intergenic
1153224714 18:2890725-2890747 GACCTCCAGTCTTCCCTTGCTGG + Exonic
1156317064 18:35979735-35979757 GCCCTACAGTGTTTCATTGTAGG + Intergenic
1163044396 19:14628739-14628761 GACAGCCAGTGTTACAAGGAAGG + Intronic
1165369512 19:35395787-35395809 GACCTCCAGGGTCACTGTGAGGG + Intergenic
926813194 2:16774655-16774677 GGTCTCCAGTGTTACACTGATGG + Intergenic
927246892 2:20964053-20964075 GAACTCCACTGTTACATGGTAGG + Intergenic
930278815 2:49345017-49345039 GACATTCAGTGATTCATTGACGG + Intergenic
932967105 2:76489388-76489410 GACTTCAAGTTTTACACTGAGGG - Intergenic
935455245 2:103259818-103259840 GACATCCAGTCTATCATTGATGG + Intergenic
941224212 2:162825908-162825930 GATATCCACTGTTACAATGATGG - Intronic
942411232 2:175710892-175710914 GAAATCCACTGTTACTTTGATGG - Intergenic
943229578 2:185230956-185230978 GACTTCATGTGATACATTGATGG - Intergenic
945981666 2:216317167-216317189 GCTCTCCAGTGATACATTGCTGG + Intronic
946992010 2:225343859-225343881 TATATCCAGTCTTACATTGATGG + Intergenic
947081035 2:226397353-226397375 GCCCTCCAGTGGCACTTTGAAGG - Intergenic
1179040751 21:37800370-37800392 AATGTCCAGTGTTACATTGTGGG + Intronic
1181537948 22:23556383-23556405 GACCCTCAGTGTGACAGTGAAGG - Intergenic
1185201946 22:49512556-49512578 GATCTCCAGTGTTCCATTCCTGG + Intronic
955353805 3:58214009-58214031 GTCCTCCAGTATTACATGGAGGG - Intronic
955356252 3:58235635-58235657 TAGCTCCAGTTTTACAGTGAAGG - Intergenic
968295554 3:197573818-197573840 TACCTCCACTGTGACATTCAAGG - Intergenic
969757732 4:9161102-9161124 GACCTCCAGGGTGACATCAAAGG + Intergenic
974666391 4:64968548-64968570 GACCCCCAGTTTTACATGGCTGG + Intergenic
975544305 4:75545897-75545919 GACCTCCAGTGGGCCCTTGAGGG + Intronic
976698191 4:87940700-87940722 GACTTCAAGTGTAACATTCATGG - Intergenic
988373391 5:30401988-30402010 CACCTCCATTGTTCCATTTAGGG + Intergenic
989256555 5:39372035-39372057 CACATCCAATGTTACCTTGAGGG - Exonic
996223750 5:120964453-120964475 TACATCCAGTCTAACATTGATGG - Intergenic
998417739 5:141957910-141957932 GTCCTCCAGTGTTTCCTGGATGG + Exonic
999960050 5:156744884-156744906 GACCTCCAGTGCAACACAGATGG + Intronic
1001261355 5:170232582-170232604 GCCTTCCAGTGTTAGTTTGAGGG - Exonic
1008722464 6:54373077-54373099 GAACACAATTGTTACATTGATGG - Intronic
1015898157 6:138036654-138036676 GACCTCAAGTGCTAATTTGAAGG + Intergenic
1017324157 6:153128063-153128085 GACTTTCAGTGTGAGATTGATGG - Intronic
1018351412 6:162962968-162962990 GACCTCTAGGGTCACTTTGAGGG + Intronic
1019415240 7:924017-924039 GACCTGCAGTGTAACCTGGAGGG - Intronic
1020734313 7:11927772-11927794 GATCTCCAGATTTGCATTGAGGG + Intergenic
1021457961 7:20849775-20849797 TACCCCCAGGCTTACATTGAAGG + Intergenic
1026591549 7:71700375-71700397 GAACTCAAGTGTGACAGTGAAGG - Intronic
1028093748 7:86734577-86734599 GACTTCCTGTGTGACATTTATGG - Intronic
1029018805 7:97342286-97342308 CACCTCCACTGTCACATTGCAGG + Intergenic
1038872676 8:31512774-31512796 GAAGTCCAGTGTTAGACTGACGG + Intergenic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1040049519 8:42999107-42999129 AAACTTCAGTGTTACAATGATGG + Intronic
1042643333 8:70958085-70958107 GCCCTCCAGTCTATCATTGATGG + Intergenic
1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG + Intronic
1050193011 9:3049158-3049180 GACCTCAAGAGTTACTTTAAAGG + Intergenic
1055675060 9:78650347-78650369 GATCTCCTGTGCTACACTGAGGG - Intergenic
1057853475 9:98583534-98583556 GACCTCCAGGGTCATATTGGTGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1189207948 X:39257778-39257800 GACCTCCAATGTCACATTGGAGG + Intergenic
1189207949 X:39257780-39257802 CACCTCCAATGTGACATTGGAGG - Intergenic
1189500734 X:41554564-41554586 GATTTCAAGTGTTACATTGGGGG - Intronic
1192002125 X:67163578-67163600 GACCTCCAGTTTTAGGCTGAAGG - Intergenic
1193441221 X:81541012-81541034 GACTTCCAGTTTTACTTTAAGGG + Intergenic
1194514300 X:94831351-94831373 GACATACATTGTTCCATTGAGGG - Intergenic
1194642439 X:96418335-96418357 GACCTTCAGTGTTAAAATCAAGG + Intergenic
1197474356 X:126902262-126902284 GACGTCCACTGTTAGACTGATGG - Intergenic
1197559461 X:127999964-127999986 GATCCCCAGTGTTACAGTGTTGG + Intergenic