ID: 1101494564

View in Genome Browser
Species Human (GRCh38)
Location 12:105241443-105241465
Sequence CACTGTACCCAAAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101494559_1101494564 5 Left 1101494559 12:105241415-105241437 CCCAAATTCTAAATGCCAGGGCT 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 217
1101494561_1101494564 -10 Left 1101494561 12:105241430-105241452 CCAGGGCTCTGCCCACTGTACCC 0: 1
1: 1
2: 3
3: 50
4: 525
Right 1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 217
1101494560_1101494564 4 Left 1101494560 12:105241416-105241438 CCAAATTCTAAATGCCAGGGCTC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101494564 Original CRISPR CACTGTACCCAAAGAGAAGA AGG Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900916041 1:5639371-5639393 CACTGTAGCCAAAGACAGCATGG - Intergenic
905467162 1:38163886-38163908 CAATGTCCCCAAAGGGCAGATGG + Intergenic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
910805988 1:91190270-91190292 CACTGTGCCCAAACAGGAGAAGG + Intergenic
913342552 1:117773214-117773236 CACTGTAAGCCAAGAAAAGATGG - Intergenic
914435442 1:147655312-147655334 CTCTGTAGACAAAGAGAAGGGGG - Intronic
914493707 1:148173108-148173130 CACTGTTCCCACAGAGAAATAGG + Intergenic
914778139 1:150757390-150757412 CACTGTTGCCAAAGTGAAGAAGG - Intronic
915336852 1:155148693-155148715 GAAGGTACTCAAAGAGAAGAAGG + Intergenic
915758241 1:158284759-158284781 AACTGAACCAAAAGACAAGAAGG - Intergenic
916229672 1:162528580-162528602 CACTGTACCCAATGTGCAAAAGG - Exonic
919399658 1:197096570-197096592 CACAGAACCCAAAGTGAATATGG - Intronic
920458705 1:206119797-206119819 CACTTGAACCCAAGAGAAGAAGG + Intergenic
920906947 1:210179572-210179594 TACTAAACCCAATGAGAAGATGG + Intergenic
922914091 1:229241316-229241338 CACTTTACCAAAAGAGAGAAGGG + Intergenic
922952499 1:229570680-229570702 GACAGTACCCAAAGGGAAAAAGG + Intergenic
923520259 1:234729985-234730007 CACTGTACATAATCAGAAGAAGG + Intergenic
923535646 1:234849354-234849376 CACTGTACAAAAAAAGAGGAAGG - Intergenic
1064747509 10:18492308-18492330 CACTGTAAACAAAGTGAATATGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070026447 10:72636598-72636620 GAAGGTACCCAAAGAGAAAAAGG - Intergenic
1070366582 10:75742657-75742679 ACCTGTACCCCAAGAGCAGAGGG - Intronic
1071029018 10:81150739-81150761 CAATCTACACAAAGAGCAGAGGG + Intergenic
1071940049 10:90580088-90580110 TACAGATCCCAAAGAGAAGAGGG - Intergenic
1072829742 10:98645138-98645160 CACTGTTGCCAAAGAGATGTAGG + Intronic
1073638053 10:105219603-105219625 CACTGTGCCAAAAGATAACATGG - Intronic
1075957167 10:126534011-126534033 TGCTGTACACATAGAGAAGAGGG + Intronic
1076596802 10:131628215-131628237 CAATGAACCCAAAGATAAGCTGG + Intergenic
1077849755 11:6063969-6063991 CATTGTTCCCAAGGAGAATATGG - Intergenic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1082108523 11:48245868-48245890 CACTCTGCCCATAGACAAGATGG + Exonic
1083244774 11:61418301-61418323 CACTGTAGCAAAAGAAAATAAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084892187 11:72242036-72242058 CAATGGGCGCAAAGAGAAGATGG - Intronic
1086931374 11:92696571-92696593 CAATGTCCCTAAAGAGAATATGG - Intronic
1087721739 11:101673243-101673265 CACTGTACCAACTGAGATGAAGG - Intronic
1088792097 11:113235201-113235223 CACTGCCCCCAGGGAGAAGAAGG - Intronic
1090206662 11:124887939-124887961 CCCTGAACCCAGAGAAAAGAGGG + Intronic
1090410173 11:126502557-126502579 CACAGCACCAAAAGAGAAAAAGG - Intronic
1090649406 11:128793266-128793288 CATGGTTCCCAAGGAGAAGAAGG + Intronic
1091111268 11:132970986-132971008 CACTGTAGCCAAGGAGATGATGG - Intronic
1092813371 12:12291833-12291855 AACTGTACTCAAAGGCAAGAAGG - Intergenic
1093250814 12:16802460-16802482 GACTGCACCCAAAGAAGAGAAGG - Intergenic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1099752210 12:86790366-86790388 CTCTGAACCTAAGGAGAAGAGGG + Intronic
1100449909 12:94695994-94696016 CACTGGACTCCCAGAGAAGATGG - Intergenic
1100858955 12:98784383-98784405 CACAGAAGCCAAAGAGGAGAGGG + Intronic
1101300309 12:103472826-103472848 CCCTGTACCCATGGGGAAGACGG + Intronic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1104292171 12:127480908-127480930 CCCTGTCTCCAAAGAGAAGGAGG + Intergenic
1104293372 12:127489154-127489176 CCCTGTCTCCAAAGAGAAGGAGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105397263 13:20049245-20049267 CCCTCTACCCAAAGAAAAAAGGG - Intronic
1106306293 13:28514210-28514232 CACTGTAACAGAAGTGAAGAAGG - Intergenic
1107700467 13:43042062-43042084 CACAGAACCCACAGATAAGAGGG - Intronic
1108001368 13:45908380-45908402 CACTTTACAGAATGAGAAGATGG - Intergenic
1109068982 13:57738548-57738570 CAATTTACACAAAGAGACGAGGG - Intergenic
1109098601 13:58149172-58149194 TACAGTACAGAAAGAGAAGAGGG - Intergenic
1109528400 13:63606383-63606405 CTCTGTGCCCATAGACAAGAGGG - Intergenic
1109726968 13:66354159-66354181 AACTTTACCCAAAGAGGAGTTGG + Intronic
1110273270 13:73615273-73615295 CACTGTTTTTAAAGAGAAGAAGG - Intergenic
1111345154 13:86942467-86942489 CTATGTACCCAAATAGAACATGG + Intergenic
1115814823 14:37152643-37152665 CACTGAAGCCAAAGAGTGGATGG + Intronic
1117149467 14:52870996-52871018 AAATGTACCCAAAGAAGAGATGG + Intronic
1118908523 14:70042026-70042048 CAATGCATCCAAAGAGAAGATGG + Intergenic
1120616000 14:86705668-86705690 CACTGTTCTCAGTGAGAAGAGGG - Intergenic
1120826689 14:88962564-88962586 CACTGGACCCAAGGCTAAGAAGG - Intergenic
1121724663 14:96138375-96138397 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1122697882 14:103566067-103566089 AACTCTAACCAAAAAGAAGATGG - Intronic
1123439053 15:20276861-20276883 CACTCTGTTCAAAGAGAAGAGGG + Intergenic
1127488451 15:59440153-59440175 CACTGGACCAGAAGATAAGAAGG - Intronic
1128700855 15:69803265-69803287 AAATGTACCCAAAAGGAAGAGGG + Intergenic
1129682942 15:77668322-77668344 CACTAAAGCCAGAGAGAAGAGGG + Intronic
1130897324 15:88181551-88181573 CCCTGTCCTCAAAGAGAACAGGG + Intronic
1133575012 16:7080613-7080635 GAGTGTACCCCAAGAGAACATGG - Intronic
1134528244 16:14961339-14961361 CACTGCACCCAGCTAGAAGAGGG + Intergenic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1136846117 16:33577483-33577505 CACTCTGTTCAAAGAGAAGAGGG - Intergenic
1136866775 16:33765633-33765655 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG + Intronic
1140342163 16:74175019-74175041 CACTGTGCCCAAAGATTAGCAGG + Intergenic
1142001846 16:87668799-87668821 CACTGTCCCCACAGTGAAAATGG + Intronic
1203105387 16_KI270728v1_random:1350569-1350591 CACTGTACCCCAAGGAAAGAAGG - Intergenic
1203107825 16_KI270728v1_random:1426137-1426159 CACTCTGTTCAAAGAGAAGAGGG - Intergenic
1203128127 16_KI270728v1_random:1611799-1611821 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1142798622 17:2329292-2329314 CACTTTCCCAAAAGACAAGATGG + Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144408283 17:14974134-14974156 CTGTGCACCCAAAGAGATGAAGG + Intergenic
1151146605 17:72047147-72047169 CCCTGAACCCAAAGGGAATAAGG - Intergenic
1152218391 17:79047614-79047636 CACTGGACCCAAAGGGCAGAAGG + Exonic
1152339709 17:79717226-79717248 CACTGTACTGAAAGTGAACATGG - Intergenic
1152341340 17:79727320-79727342 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1153604889 18:6823125-6823147 ACCTGAACCCAAAGACAAGAAGG + Intronic
1155965797 18:32034181-32034203 GAAGGTACCCAAAGAGAAAAAGG - Intronic
1158488331 18:57888147-57888169 CAGTGTAACCAATGAGTAGAAGG + Intergenic
1163368062 19:16887416-16887438 CACTCTGCTCACAGAGAAGACGG + Intergenic
1163735591 19:18978384-18978406 CACTGCACCCAACCAGAAGGGGG - Intergenic
1164293649 19:23889717-23889739 CATTCTTCCCATAGAGAAGATGG + Intergenic
1164294857 19:23900931-23900953 CACCATGCACAAAGAGAAGATGG + Intergenic
1165035015 19:33026629-33026651 CACTCTGTTCAAAGAGAAGAGGG + Exonic
1166777435 19:45321781-45321803 CACTGGACCCAGAAAGGAGAAGG + Intronic
1167861100 19:52284726-52284748 CAAAGTAACCAAACAGAAGAAGG - Intronic
1167909183 19:52688175-52688197 CCCTGTTACCAAAGAAAAGAAGG - Intronic
1167964434 19:53132043-53132065 CACAGTATCCAGAGAGATGAAGG - Intronic
1168171959 19:54595280-54595302 CACGGGGCCCACAGAGAAGATGG - Exonic
1168210725 19:54888172-54888194 CACAGGACCCAAAGAGAAGTTGG - Exonic
925009540 2:471671-471693 CGCTGACACCAAAGAGAAGAGGG - Intergenic
925490679 2:4389722-4389744 CATGGTAGCCAAAGTGAAGAGGG + Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
929300252 2:40295935-40295957 CAGTGTACCCAAGGAAAGGAGGG + Intronic
931067631 2:58604687-58604709 CACAGCAGGCAAAGAGAAGAGGG - Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
933714722 2:85351554-85351576 AAAAGTACCCAGAGAGAAGATGG + Intronic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
938195460 2:129323628-129323650 CACTGTAAGCAAAGAGAAGAGGG + Intergenic
939133950 2:138272254-138272276 CACTCTGCCTAAAGAAAAGAAGG - Intergenic
941731619 2:168923817-168923839 CACCGTCTGCAAAGAGAAGATGG + Exonic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
1168844023 20:930103-930125 CTCTGTCCCAAAAAAGAAGAAGG - Intergenic
1169109482 20:3022668-3022690 CACTGTAGCCAGAGAGCAGGGGG - Exonic
1169475502 20:5927852-5927874 CACCGTACGCAGACAGAAGATGG + Intergenic
1170729188 20:18957601-18957623 TACTGAACCCAAAGAGATGGGGG + Intergenic
1172071672 20:32261882-32261904 TAATGGACCCAAAGAGCAGAGGG - Intergenic
1172602409 20:36193026-36193048 CTGTCTACCCAAGGAGAAGAAGG - Intronic
1173135741 20:40437335-40437357 CATTGTACCAAAAGTGAAGAAGG + Intergenic
1173303248 20:41823158-41823180 CACTGAAGCCAAAGATAAAAGGG - Intergenic
1174656243 20:52174754-52174776 GAATGTACCCAAAGAAATGAGGG - Intronic
1175590595 20:60188216-60188238 TACAGTCCCCAAAGAGATGAAGG - Intergenic
1177389634 21:20451108-20451130 AACTGTAACCAATGAGAAGCAGG + Intergenic
1178194955 21:30334032-30334054 CACTGTTTCTAAAGACAAGAGGG - Intergenic
1178610983 21:34079728-34079750 AATTGTACATAAAGAGAAGAGGG - Intronic
1179099146 21:38341531-38341553 CCCTTTCCCCAAAGAGAACAAGG - Intergenic
1180189316 21:46155001-46155023 CACTGGACCCAAAACGAAGTAGG - Intronic
1182970041 22:34565127-34565149 CACAGGAGCAAAAGAGAAGATGG - Intergenic
1183008932 22:34928756-34928778 CACTGGACCCAAGCAGAAGCTGG + Intergenic
1183936293 22:41264347-41264369 CACTGTACCCGCAGAGCAGCTGG - Intronic
1184637360 22:45844197-45844219 CCCAGTACCCAAAATGAAGAGGG - Exonic
950669195 3:14515257-14515279 CACTGTAGCCAAATAGTGGAAGG - Intronic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
955319402 3:57963686-57963708 AACTGTCCCCAAAGAGAACTAGG + Intergenic
957022960 3:75144504-75144526 CCCTGTATCCAAAGAAAAGGAGG + Intergenic
958167155 3:89890669-89890691 CACTGTAGCAAAAAAAAAGATGG - Intergenic
958712381 3:97732996-97733018 CACTGTCCCCACAGAGAGGCCGG + Intronic
960219418 3:115087514-115087536 GACAGTAGCCAAAGAAAAGAAGG + Intronic
960257368 3:115525004-115525026 CACTGTACCCAAGGAGGGGGAGG + Intergenic
961848762 3:129793941-129793963 CACTGATTCCACAGAGAAGAAGG + Intronic
963032942 3:140997109-140997131 CAATGTAACCAAACTGAAGAGGG - Intergenic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
966113201 3:176428613-176428635 GACACTGCCCAAAGAGAAGAGGG + Intergenic
966344425 3:178962705-178962727 CCCTGTACACACAGAGAAAAAGG + Intergenic
970072812 4:12181396-12181418 AACATTACTCAAAGAGAAGATGG + Intergenic
970883935 4:20965013-20965035 CTATTTAACCAAAGAGAAGATGG + Intronic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
974013385 4:56627157-56627179 CACCATACCCATGGAGAAGAAGG + Intergenic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
976229715 4:82828999-82829021 CAGAGTACCCAAAAAGAAGAAGG - Exonic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
986321760 5:6637253-6637275 CACTGTAATCACAGAGCAGAGGG - Intronic
987073245 5:14357899-14357921 CACTGTCACAAAAGAGAAAAAGG - Intronic
991144352 5:63283412-63283434 CACAGGACCCAAAGGCAAGATGG + Intergenic
992497071 5:77304474-77304496 CACTGTAATAAAAGAGAAAAAGG - Intronic
993094360 5:83464514-83464536 CACTGAAACCAAAGTGTAGAAGG - Intergenic
993371386 5:87096919-87096941 CACTGAATCCTGAGAGAAGATGG - Intergenic
995287827 5:110411902-110411924 TACAGTACTCAAATAGAAGAGGG - Intronic
995411642 5:111864259-111864281 CTATGTACCCAATGAAAAGATGG + Intronic
996188277 5:120506879-120506901 CACTGTGCTCAAAGATAAGATGG - Intronic
998650148 5:144109912-144109934 CATAGAACCCAAAGACAAGAGGG + Intergenic
999086728 5:148898704-148898726 CACATTTCTCAAAGAGAAGAGGG - Intergenic
999124336 5:149235915-149235937 CACTGGACCTAAAAAGATGAGGG + Intronic
1000382659 5:160643003-160643025 CACTGTACCAAAAAAGAAAATGG - Intronic
1000943379 5:167391029-167391051 CACTGCAGCCAAAAAGAACAGGG - Intronic
1002629734 5:180563529-180563551 GACTGGACTCAAAGAGCAGAAGG - Intronic
1004353506 6:14911739-14911761 TCCTATACCCAAAGAGAGGAAGG + Intergenic
1005910882 6:30308528-30308550 CACTGCAGCGAAAGAGAAGATGG + Intergenic
1008889019 6:56463784-56463806 CAATGCACACAAAGAAAAGACGG + Intronic
1010123681 6:72409164-72409186 GACTGTACACAAACACAAGATGG + Intergenic
1011556968 6:88580756-88580778 AACTGTACACAATGATAAGAGGG - Intergenic
1013811029 6:114044723-114044745 CAGTGGACTCAAAGAGAAGCAGG - Intergenic
1016571206 6:145515112-145515134 CTCAGTAGCCAAAGACAAGAAGG + Intronic
1017212529 6:151872702-151872724 TACTGTAACCAAAGCAAAGAGGG - Intronic
1017375173 6:153760401-153760423 CACTGTACCTAGAAAGGAGAAGG + Intergenic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018142307 6:160850908-160850930 CACTGAACCCACAGAAAAGACGG + Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1019763205 7:2829717-2829739 CACCGTCCCTAAAGAAAAGAGGG - Intronic
1021768142 7:23969835-23969857 CCCTCAACCCAAAGAGAGGAAGG - Intergenic
1022582662 7:31571378-31571400 CAATGTTCCCAAGGAGAACAAGG - Intronic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1023862070 7:44222730-44222752 CACTGTGCCCAGCCAGAAGAGGG + Intronic
1024216948 7:47255957-47255979 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1026190782 7:68124388-68124410 CTCTCTACCCAAAAAGAAAAAGG - Intergenic
1026354820 7:69548422-69548444 CACTGCACCCAGCCAGAAGATGG - Intergenic
1026683586 7:72489191-72489213 CCCTGTTTCCAAAGAGGAGATGG - Intergenic
1027297058 7:76787275-76787297 CACTGTAAGAAAAGAGATGATGG - Intergenic
1029177039 7:98672111-98672133 CCCTGGATCCAGAGAGAAGATGG + Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029959898 7:104679567-104679589 CACTGTAGCCAAATGAAAGAAGG + Intronic
1035539128 8:418185-418207 CACTGTCCCCAAAACGCAGATGG - Intronic
1036505076 8:9347620-9347642 CACCGTACCCCAAGATAACAGGG - Intergenic
1037553366 8:19996904-19996926 CACTTTTCCCAAAGGCAAGATGG + Intergenic
1039545410 8:38406984-38407006 CACTGAATCTAAAGAGAACATGG + Exonic
1039920742 8:41892595-41892617 CACTGCACCAAAAGATTAGATGG + Intronic
1040623349 8:49115249-49115271 CACTGGACTCAAAGACAAGTCGG + Intergenic
1041422505 8:57683855-57683877 CATTGGACCCAAAGAAAAAAGGG + Intergenic
1043556397 8:81435501-81435523 CACTGTTCCAAAAGAGAAAGGGG - Intergenic
1044450691 8:92332991-92333013 CACTCCACCCAAAAACAAGAGGG - Intergenic
1046711064 8:117512196-117512218 AAGTGAACCCAAAGAGAAGCAGG - Intergenic
1046741925 8:117838318-117838340 CAATATACCCAAAAAGAAGAGGG - Intronic
1047429875 8:124781883-124781905 CAGTGAAGCCAAAGAGGAGAAGG + Intergenic
1047881011 8:129193338-129193360 CATTGTTCCCAAAGAGAGTAGGG + Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1051874444 9:21776596-21776618 GTCTGTGACCAAAGAGAAGATGG + Intergenic
1051908570 9:22126527-22126549 AAGTATACCCAAAGAGAAAAAGG - Intergenic
1052597543 9:30579209-30579231 CAATGTGCCCAAATAGCAGAGGG - Intergenic
1053354520 9:37434553-37434575 CACTGCAACCAAAGAGGAGGAGG + Intronic
1055575632 9:77657981-77658003 CACTGTACCGTGGGAGAAGAAGG + Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1058991481 9:110257935-110257957 CAATGTTCCCAAAGAGAGGGAGG + Intergenic
1059485126 9:114621047-114621069 CACTGCACCCAGAGAGGAAAAGG - Intronic
1060677415 9:125528119-125528141 CACTGTACTCAAGGAAAAGCGGG + Intronic
1060743596 9:126115263-126115285 TCCTGTTCCCAAAGAGGAGAGGG - Intergenic
1061320995 9:129829302-129829324 AACTGGACCCAAAGAGACCAGGG + Exonic
1061419001 9:130463270-130463292 CTCTGTCCCCAGAGAGAAAATGG - Intronic
1061939184 9:133874943-133874965 CACCTTACACACAGAGAAGACGG + Intronic
1062011906 9:134271918-134271940 CACTGCACCCAAGCAGAAGGAGG + Intergenic
1185633628 X:1535754-1535776 CTCTGTTCCCAAAAAGAAAAGGG - Intronic
1189901621 X:45712560-45712582 CACTGTACTCACAGAGAAGGTGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1196220206 X:113105021-113105043 CACTGAACCAAAGGAGATGAAGG - Intergenic
1198329452 X:135608398-135608420 CACAGTCCCTGAAGAGAAGATGG + Intergenic
1198514201 X:137388073-137388095 CAGTGTAGCTAAATAGAAGAAGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200985945 Y:9303728-9303750 CACTGCACCCAAAGAGCTGTAGG + Intergenic
1202195344 Y:22294905-22294927 CGCTGTACCCAAAGAGCTGTAGG + Intergenic