ID: 1101498823

View in Genome Browser
Species Human (GRCh38)
Location 12:105281844-105281866
Sequence AAGGGAAAACAGAAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 842}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101498817_1101498823 20 Left 1101498817 12:105281801-105281823 CCTTGTGGCTTGGAAAGGAAAGT 0: 1
1: 0
2: 1
3: 24
4: 248
Right 1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG 0: 1
1: 0
2: 6
3: 69
4: 842
1101498816_1101498823 23 Left 1101498816 12:105281798-105281820 CCACCTTGTGGCTTGGAAAGGAA 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG 0: 1
1: 0
2: 6
3: 69
4: 842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101498823 Original CRISPR AAGGGAAAACAGAAGGAGCC TGG Intronic
900098390 1:949828-949850 AAGGGGAATCAGAACGTGCCTGG + Intronic
900692980 1:3992857-3992879 AAGGGAGCACAGAAAGGGCCTGG - Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900854510 1:5170271-5170293 AAGGGAACAAAGAATAAGCCAGG + Intergenic
902132239 1:14272320-14272342 AAATGCAAACAGAAGCAGCCAGG + Intergenic
902231231 1:15028972-15028994 AAAGAAAAACAGAAGAGGCCAGG - Intronic
902439136 1:16417893-16417915 AATGGAATACAGACAGAGCCAGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
903355057 1:22741350-22741372 GAGGGAAAACAGACGGCTCCAGG - Intronic
903467425 1:23561559-23561581 ATGGGAAAATAGAAGCACCCAGG - Intergenic
903957466 1:27035235-27035257 AAGCTGAAACACAAGGAGCCGGG - Intergenic
904026780 1:27508959-27508981 AAAGGAAACAAAAAGGAGCCAGG - Intergenic
904501321 1:30914456-30914478 AGGAAAAAACAGAGGGAGCCTGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905052403 1:35063044-35063066 AAGAGAAGACGGAAGGAGTCTGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905272540 1:36796325-36796347 AAAGGCAGACAGATGGAGCCTGG + Exonic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
907393733 1:54175442-54175464 AAGGGCAGAGAGAAGGATCCTGG - Intronic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907849792 1:58245249-58245271 AAGTGAAAGCAGAAGGTGCCTGG + Intronic
908029287 1:59982722-59982744 AAAGGAAAAGAAAAGGAGCTAGG - Intergenic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
908269571 1:62410091-62410113 AAGGGAAACCTGAAGAAGTCCGG + Intergenic
908294805 1:62703222-62703244 AATGGAAAACAGAAAAAGGCAGG - Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908450960 1:64254081-64254103 AATGGAAAACAGAAAAAGGCAGG + Intronic
909439317 1:75679930-75679952 AATGGAAAACAAAAGAAGGCAGG + Intergenic
909448192 1:75770776-75770798 AGGGGACAACAGAGGGAGACAGG - Intronic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910111486 1:83688334-83688356 AATGGAAAACAAAAAGAGGCAGG - Intergenic
910190583 1:84590921-84590943 AATGGAAAACAGAAGAAGCAGGG + Intergenic
910610493 1:89135981-89136003 AATGGAAAACAAAAAGAGCAGGG + Intronic
911124515 1:94328456-94328478 ATGGGAAAACAGAAGGTTCCCGG + Intergenic
911823089 1:102444383-102444405 AATGGAAAACAGAAAAAGGCAGG + Intergenic
911929712 1:103886370-103886392 AATGGAAAACAGAAAAAGGCAGG + Intergenic
912108814 1:106314702-106314724 AATGGAAAACAAAAAGAGGCAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
912301844 1:108525970-108525992 AATGGAAGACAGAAAGAGACTGG + Intergenic
912370235 1:109168062-109168084 AAGTGAAGACAGAAGGAACTTGG - Intronic
912686884 1:111774915-111774937 AGGGGAGAACGGAAGGACCCAGG - Intronic
912782426 1:112564217-112564239 AAGGGAAAAGGAAAGGAGGCTGG + Intronic
913273490 1:117116854-117116876 AAGAGAAAACAAAGGGACCCAGG - Intronic
913337598 1:117722983-117723005 AACGGAAAACAAAAGAAGGCAGG + Intergenic
913434613 1:118833739-118833761 AATGGAAAACACAAAGAGGCAGG + Intergenic
913493302 1:119403153-119403175 AATGGAAAACAAAAAAAGCCAGG - Intergenic
914838538 1:151228579-151228601 AAGGGAAAACAGAAGCATCCTGG + Intronic
914863933 1:151409630-151409652 AAGGGAAAAAAGTAAGGGCCAGG - Intronic
914950507 1:152109814-152109836 ACGGGAGAAGAGAAGGCGCCAGG - Exonic
914950562 1:152110174-152110196 ACGGGAGAAGAGAAGGCGCCAGG - Exonic
915212549 1:154321309-154321331 TAAGGACAACAGAAGGAGCCAGG - Intronic
915283481 1:154838313-154838335 ATGGTATAGCAGAAGGAGCCCGG - Intronic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915730143 1:158047633-158047655 CAGGGACAACAGAATGATCCTGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
916643069 1:166752636-166752658 AATGGAAAACAGAAAAAACCAGG + Intergenic
916741619 1:167651380-167651402 CAGGCATGACAGAAGGAGCCAGG - Intronic
916750402 1:167718500-167718522 AAGGGAAAAGAGAGAGAGCAGGG - Intergenic
916958753 1:169867734-169867756 AAGAGACAACAGTAGGAGCCAGG - Intronic
917055356 1:170975974-170975996 AATGGAAAACAGAAAAAGGCTGG - Intronic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
918162370 1:181913290-181913312 TTGGGAAAACAGAAGTATCCAGG + Intergenic
918826287 1:189329092-189329114 AATGGAAAACAAAAAAAGCCAGG - Intergenic
919015534 1:192028879-192028901 AATGGAAAACAGAAAGAAGCAGG - Intergenic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919574241 1:199287036-199287058 TATGGAAAACAGCAGCAGCCTGG + Intergenic
919827268 1:201512176-201512198 AGGGGAAAGCAGGAGGAGCTGGG + Intergenic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
920791220 1:209094800-209094822 ATGGGAAAACAGAAAGACCTGGG - Intergenic
920837986 1:209529686-209529708 TGGGGAGAACAGATGGAGCCAGG + Intergenic
921593465 1:217029793-217029815 AAGTGAAAAGAAAAGGAGTCAGG + Intronic
921723092 1:218495236-218495258 AAGGGAAGAAAGAAGAAGCCCGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
923455944 1:234165679-234165701 AAAAGAAAAAAGAATGAGCCAGG - Intronic
924141407 1:241027583-241027605 AAGGGAGATGAGAATGAGCCTGG + Intronic
924430129 1:243989567-243989589 ATGGCAACAGAGAAGGAGCCTGG - Intergenic
924667744 1:246090810-246090832 AAAAGAAAAGAGAAAGAGCCGGG - Intronic
1062776433 10:152383-152405 AATGGAAAACAGAAAAAGGCAGG + Intronic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065427666 10:25621844-25621866 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1066159910 10:32716715-32716737 AATGGAAAACAGAAAAACCCAGG + Intronic
1066446300 10:35486853-35486875 AAGTGACAGCAGGAGGAGCCTGG - Intronic
1067171353 10:43909342-43909364 AAGAGAAAAGAAAAGAAGCCAGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068513868 10:58002096-58002118 AAAGGAAAAAAGAAGCAGTCAGG - Intergenic
1068990816 10:63148561-63148583 AAGGGCAAACAGAGGGGACCTGG + Intronic
1069929719 10:71874273-71874295 TGGGGAAAAGAGAAGGATCCCGG - Intergenic
1070270359 10:74948140-74948162 CAGGGAAAACAAAAGAAGTCAGG + Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070973074 10:80583371-80583393 AAAAGACAACAGATGGAGCCGGG + Intronic
1071066005 10:81636962-81636984 ACAGCAAACCAGAAGGAGCCTGG - Intergenic
1071247852 10:83784883-83784905 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1071359288 10:84829536-84829558 AAAAGAAAAGAGAAGGAGCTGGG + Intergenic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073415604 10:103379156-103379178 ATCAGAAACCAGAAGGAGCCAGG - Intronic
1073769029 10:106715070-106715092 AATGGAAAACAGAAAGAAACTGG + Intronic
1074449327 10:113546402-113546424 AAGCGGAAACAGACAGAGCCAGG + Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074567093 10:114589701-114589723 AAAAGAAAAAAGAAAGAGCCAGG - Intronic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1075245420 10:120818077-120818099 AAGGAAAGAAAGAAGGGGCCAGG - Intergenic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075375243 10:121973606-121973628 AAGGCAAAACAGAATGGGACAGG + Intronic
1076037328 10:127210724-127210746 AAAGGAAAACAAAAAGAGGCAGG - Intronic
1076050457 10:127329318-127329340 ATAGGACAACAGGAGGAGCCTGG + Intronic
1076268343 10:129129029-129129051 AAGGGACTTCAGAAAGAGCCAGG - Intergenic
1076268352 10:129129072-129129094 AAGGGACTCCAGAAAGAGCCAGG - Intergenic
1076268361 10:129129115-129129137 AAGGGACTCCAGAAAGAGCCAGG - Intergenic
1076268370 10:129129158-129129180 AAGGGACTCCAGAAAGAGCCAGG - Intergenic
1076268379 10:129129201-129129223 AAGGGACTCCAGAAAGAGCCAGG - Intergenic
1076268388 10:129129244-129129266 AAGGGACTCCAGAAAGAGCCAGG - Intergenic
1076268395 10:129129287-129129309 GAGGGACTCCAGAAGGAGCCAGG - Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1077125005 11:929633-929655 AAGAGAAAAAAGAATTAGCCAGG + Intronic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1078524582 11:12090731-12090753 AAAAGAAAAAAGAAGGAGCCAGG + Intergenic
1078697015 11:13644546-13644568 AAGGCAAAAAGGAAGGAGGCAGG + Intergenic
1078806618 11:14712062-14712084 AACAGAAAACAGAAGTAGACAGG - Intronic
1079170244 11:18086829-18086851 AATGAAAAACAGTATGAGCCTGG + Intronic
1079628949 11:22650742-22650764 AATGGAAAACAGAAAAAGGCAGG - Intronic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1080291235 11:30673849-30673871 AAGGGATGACAGATGGAACCTGG + Intergenic
1081684007 11:45028657-45028679 ATGGGAAAAGAGAAGGGGCTTGG - Intergenic
1081701083 11:45153251-45153273 AAGGGAACTGAGAAGGAGCCAGG + Intronic
1081905403 11:46666221-46666243 AACGGGAAACAGCAGGAGCTCGG + Intronic
1082102970 11:48189569-48189591 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1082118053 11:48348297-48348319 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1082145023 11:48656564-48656586 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082744430 11:56946686-56946708 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082845735 11:57723903-57723925 AAAGGAAAACAAAACAAGCCAGG + Intronic
1083619048 11:64039977-64039999 AAGGGAAAACAGAAGAGCCAGGG - Intronic
1084052222 11:66607346-66607368 AAGGGAAAACAGACAGGGACTGG - Intergenic
1086926747 11:92648940-92648962 AAGGGAGAGCAGAAGGAGAGGGG - Intronic
1087132271 11:94678637-94678659 AAGGAAAAACTGAAGGAGTGAGG - Intergenic
1087487975 11:98782586-98782608 AGGGGGAAAAAAAAGGAGCCCGG + Intergenic
1087787592 11:102372991-102373013 AATGGAAAACAAAAAGAGGCAGG - Intronic
1088881331 11:113975624-113975646 AAGGGAGCAGAGAAGTAGCCTGG + Intronic
1089007242 11:115102423-115102445 AATGGAAAACAGACTAAGCCAGG - Intergenic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089314115 11:117579002-117579024 AAAGGAAAACAGAAGAATCAAGG - Intronic
1089667449 11:120029472-120029494 AGGGAAAAAGAGGAGGAGCCAGG + Intergenic
1089785458 11:120904010-120904032 AAGACAACACAGAAGCAGCCAGG - Intronic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090920481 11:131201982-131202004 AAGGGAAGACAGCAGGACACTGG - Intergenic
1091185491 11:133642978-133643000 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1091799209 12:3314115-3314137 AACGGAACACAGATGGGGCCAGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092709752 12:11323280-11323302 AAGAGAAACCAGCAGGAGCAAGG + Intergenic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1092828840 12:12424134-12424156 AAAGGAAAACAGAAAGAGAAAGG - Intronic
1093996893 12:25652767-25652789 AAGGCAGAAAAGAAGAAGCCTGG + Intergenic
1094387641 12:29912204-29912226 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094803974 12:34070645-34070667 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1094805408 12:34085539-34085561 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1095066941 12:37789209-37789231 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095089853 12:38093632-38093654 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095534565 12:43229905-43229927 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095639617 12:44472813-44472835 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1095718382 12:45373029-45373051 AATGGAAAACAGAAAAAGGCAGG + Intronic
1096088489 12:48882660-48882682 AGGGAATAAGAGAAGGAGCCAGG + Intergenic
1096150675 12:49309787-49309809 AAAAGAAAAGAAAAGGAGCCGGG + Intergenic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096359865 12:50974807-50974829 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1097218580 12:57433044-57433066 AGGGCAAAAAAGAAGGAGACAGG + Intergenic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1098004322 12:65979527-65979549 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1098347643 12:69523399-69523421 AATGGAAAACAGAAAAAGCAGGG - Intronic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099357922 12:81661366-81661388 AATGGAAAACAGAAAAAGGCAGG + Intronic
1099538369 12:83873264-83873286 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1099608956 12:84840846-84840868 AAGGAAATACAGGATGAGCCGGG - Intergenic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1099942836 12:89210438-89210460 AAAGGAGAAGAGAAGGAGACAGG + Intergenic
1100438435 12:94593204-94593226 AAGAAAAAACAAAAAGAGCCAGG + Intronic
1100552797 12:95662205-95662227 AAGGAAGAACAGAAGGAGAGGGG - Intronic
1101157697 12:101943440-101943462 ACTGGAATAGAGAAGGAGCCTGG - Intronic
1101173357 12:102122460-102122482 AAAGGATAGCAGAAGGAGTCAGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101524654 12:105517687-105517709 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1101622278 12:106400151-106400173 AATGGAAAACAGAAAAAGGCAGG + Intronic
1102161378 12:110771814-110771836 AAAGAAAAAAAGAATGAGCCAGG + Intergenic
1103069336 12:117927697-117927719 AAAGGAAAAAAAAAGGAACCAGG + Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104111759 12:125710906-125710928 AAGGGAAAAGGGAAAGAGCCTGG + Intergenic
1104427250 12:128687917-128687939 AAGGGAAAACAGTGTGAGCCGGG - Intronic
1104472467 12:129041373-129041395 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1104713424 12:131001698-131001720 ACCGGAAGACAGATGGAGCCAGG - Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1105951930 13:25236731-25236753 AGGGGAATACAGAACGAGGCTGG + Intergenic
1106257592 13:28035643-28035665 AAGAGATCACAGAAGGAGTCTGG - Exonic
1106715949 13:32387996-32388018 AAGAGAAAACAGCTGGACCCAGG - Intronic
1106726639 13:32493219-32493241 AAAGGAAAAAAGAAAGAGACTGG - Intronic
1106991470 13:35425971-35425993 AATGGAAAACAGAAAAAGCCAGG - Intronic
1107034182 13:35883383-35883405 AAGGGAGAAGGGAAGGTGCCAGG - Intronic
1107187714 13:37544465-37544487 AATGGAAAACAGAAAAAGCAGGG - Intergenic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107424197 13:40276399-40276421 AACAGGCAACAGAAGGAGCCCGG + Intergenic
1107550310 13:41468382-41468404 AAGGGAAGATAAAAGGAGTCTGG - Intronic
1107558348 13:41538568-41538590 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108746971 13:53405828-53405850 AGGGGAACACAGAAGCACCCAGG - Intergenic
1109730660 13:66409154-66409176 AAATGAAAAAAAAAGGAGCCAGG + Intronic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112393136 13:99003348-99003370 AAGGGACAGGAGAAGGAGCTGGG - Intronic
1112575358 13:100630705-100630727 AAAGGAAAACAGCAGGAGCTTGG - Intronic
1112845199 13:103634218-103634240 AACTGAAAGCAGAAGGACCCAGG - Intergenic
1112873696 13:104007738-104007760 AATAGAGAACAGAAGAAGCCAGG + Intergenic
1113211039 13:107981653-107981675 AAGGAAAGAAAGAAGGAACCTGG - Intergenic
1114274846 14:21133691-21133713 GAAGGAAGATAGAAGGAGCCTGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115412406 14:33090315-33090337 AATGGAAAACAAAAGAAGGCAGG + Intronic
1116055806 14:39862640-39862662 AAGGGAAAAAAGAGGGAAACAGG + Intergenic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117140936 14:52791025-52791047 ATGGGAGAAGAGAAGGGGCCTGG + Intronic
1117188755 14:53270234-53270256 AATGGAAAACAAAAAAAGCCAGG - Intergenic
1117837576 14:59823335-59823357 AAGGGAAACGAGAAAGAGCAGGG - Intronic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118375534 14:65173664-65173686 AAGGAAAATCAGAAGCAGACAGG + Intergenic
1118448583 14:65875506-65875528 AATGGAAAACAGAAAAAGACAGG - Intergenic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119738814 14:77000592-77000614 AGGAGAAGACAGAGGGAGCCAGG - Intergenic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120145349 14:80972967-80972989 AAGGGAAAACAGATGTAAACAGG + Intronic
1120525819 14:85575739-85575761 GAGGGAAGACAGAATGAGCCTGG + Intronic
1120709550 14:87779277-87779299 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121299099 14:92855106-92855128 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1121314688 14:92953879-92953901 AAAGAAAAACAGAATTAGCCAGG - Intronic
1122253889 14:100462910-100462932 AAGGGAAAAAGGAAGGAGCGGGG - Intronic
1122253907 14:100462965-100462987 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122253923 14:100463020-100463042 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122624333 14:103076433-103076455 AAGAAAAAAAAAAAGGAGCCAGG - Intergenic
1202836649 14_GL000009v2_random:82529-82551 AATGGAAAACAGAAGAAATCAGG + Intergenic
1123723643 15:23081622-23081644 ACTGCAGAACAGAAGGAGCCTGG + Intergenic
1123822586 15:24045492-24045514 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1124078054 15:26464415-26464437 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1124434786 15:29638129-29638151 AAGGGAAATCAAAAGGAATCTGG + Intergenic
1125123950 15:36197551-36197573 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126512719 15:49498789-49498811 AATGGAAAACAAAAAGAGCAAGG + Intronic
1126567070 15:50112185-50112207 AAAGGGAAAAGGAAGGAGCCAGG + Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1126939703 15:53753662-53753684 AAGGGAAAGTAGGAAGAGCCAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127121431 15:55775440-55775462 AAGAGACTACAGAGGGAGCCTGG - Intergenic
1128524023 15:68398319-68398341 AATGGAAAACAGAAAAAGGCAGG + Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128878760 15:71224040-71224062 AACGGAGAACTGGAGGAGCCAGG + Intronic
1129468135 15:75735474-75735496 AAGGGAAAACAGCTGGGCCCAGG - Intergenic
1129518999 15:76174029-76174051 ACAGAAAAACAGAAGGAGCCTGG - Intronic
1129608760 15:77037403-77037425 AAGGAACAAGGGAAGGAGCCTGG + Intergenic
1130134693 15:81172797-81172819 AAGGAAAAAAAAAAGGAGTCAGG + Intronic
1130897428 15:88182261-88182283 TTGGGAAAACACAAAGAGCCTGG + Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1132291286 15:100705530-100705552 TAGGGAATAAAGAAGCAGCCAGG + Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132872201 16:2120539-2120561 AAGGAAAAAAAGAATCAGCCAGG + Intronic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1134520327 16:14916356-14916378 AAGGAAAAAAAGAATCAGCCAGG - Intronic
1134551248 16:15139618-15139640 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1134708001 16:16315007-16315029 AAGGAAAAAAAGAATCAGCCAGG - Intergenic
1134715214 16:16355040-16355062 AAGGAAAAAAAGAATCAGCCAGG - Intergenic
1134951601 16:18353638-18353660 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1134959543 16:18397119-18397141 AAGGAAAAAAAGAATCAGCCAGG + Intergenic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1135683273 16:24477171-24477193 CAGGGAAACTAGAAGAAGCCTGG - Intergenic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1136136158 16:28258233-28258255 AAGGGAACATAGGAGGACCCAGG + Intergenic
1136600339 16:31282542-31282564 AATGGAAAACAGAAAAAACCAGG - Intronic
1136983235 16:35077091-35077113 AATGGAAAACAAAAGAAGACAGG + Intergenic
1136992442 16:35162332-35162354 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1137306745 16:47208042-47208064 AAGGTAACACAGCAGGAGACTGG + Intronic
1137681089 16:50345586-50345608 AATGGAAAACAGAAAAAGGCAGG + Intronic
1137727159 16:50664858-50664880 AAAGGAAAATGGAAGGAGGCTGG - Intergenic
1137879862 16:52034806-52034828 AGGGCAGAAGAGAAGGAGCCTGG - Intronic
1137912819 16:52395377-52395399 AAGGAAGAGCAGAAAGAGCCTGG + Intergenic
1137951023 16:52783463-52783485 AAGGGAAGACAGAAGCAACATGG - Intergenic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1141169503 16:81682267-81682289 AAAGAAAAAAAGAAGCAGCCAGG + Intronic
1141422110 16:83924116-83924138 ACGGGAAGACAGGAGGAACCCGG + Exonic
1142713804 17:1737311-1737333 AAGGGTATGCAGAAGGACCCAGG + Intronic
1142786964 17:2231899-2231921 AGAGGAAAACAGAGGGAGCCAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1142935106 17:3323190-3323212 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1143060323 17:4195243-4195265 AAGGGTAAAGAGAAAGAACCAGG - Intronic
1143253602 17:5539887-5539909 AAGAGAAAACAGATAGACCCAGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143654528 17:8286094-8286116 CATGGGAAACAAAAGGAGCCAGG - Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1145396559 17:22500773-22500795 AATGGAAAACAGAAAAAGGCGGG - Intergenic
1145938873 17:28730955-28730977 AAGGAAAGAAAGAAGGGGCCGGG + Intronic
1146269694 17:31476839-31476861 AAAGGAAAACCAAAGGTGCCCGG - Intronic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146568055 17:33930268-33930290 AATGAAACACAAAAGGAGCCAGG - Intronic
1146735058 17:35231895-35231917 AAAGGAAAGGAGAAAGAGCCAGG + Intergenic
1147041329 17:37721594-37721616 ATGGGAAAAGAGAAGCAGCCGGG - Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147511833 17:41076591-41076613 ATGAGAAAACATAAGGAGTCAGG + Intergenic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147991600 17:44337271-44337293 AAGAGAAAACAGCTGGACCCTGG + Intergenic
1148076784 17:44941721-44941743 AAGGGAAGGCAGAGGGTGCCTGG + Intronic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1149182229 17:53952912-53952934 AAGAGCAAAGAAAAGGAGCCAGG + Intergenic
1149352778 17:55808763-55808785 AAAGGAAAACTGAAGAACCCTGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149537123 17:57441647-57441669 AAGGGAAAAGAAAGGGACCCTGG - Intronic
1149629933 17:58114346-58114368 AAGGGAACCCAGGTGGAGCCAGG - Intergenic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1149871586 17:60186867-60186889 AGGGACAAACAGAAGGATCCCGG - Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152204699 17:78968278-78968300 AAGGGAAAAATGCAAGAGCCTGG + Intergenic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1153721205 18:7905292-7905314 AAGGCAAAAAAGAAAGAACCAGG - Intronic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1156071433 18:33215848-33215870 AAGTCAAAGCAGGAGGAGCCAGG + Intronic
1157355156 18:46926909-46926931 AATGGAAAACAGAAAAAGACAGG - Intronic
1157618738 18:49003239-49003261 AAGGGAAAAAGGAAGGGGACAGG - Intergenic
1157634343 18:49135372-49135394 AAGGCAAGTCATAAGGAGCCTGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158660019 18:59378680-59378702 AAAGGAAAACAGAACCAGCACGG + Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1160219235 18:76960503-76960525 TAGGGAGACCAGAGGGAGCCTGG - Intronic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1161771864 19:6235308-6235330 GAGGGACACCAGCAGGAGCCTGG + Intronic
1162347284 19:10126672-10126694 AAAGGAAAAAAAAAGAAGCCAGG + Intergenic
1162783528 19:13020168-13020190 AGGGGAGAAGAGAAGGAGGCTGG + Intronic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164314165 19:24072146-24072168 AAAGAAAAACAGAAAGAGACTGG - Intronic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164933095 19:32190320-32190342 AGGAGAAAAGGGAAGGAGCCAGG + Intergenic
1164986542 19:32652630-32652652 GAGGAAAAACAAAAGGAGACAGG + Intronic
1164991006 19:32683913-32683935 AAAGGAAAAAAGAAGAGGCCAGG - Intergenic
1165058915 19:33195327-33195349 AAGGGAAAACAGGAGTCCCCTGG - Intronic
1166194521 19:41197208-41197230 ATTACAAAACAGAAGGAGCCTGG + Intronic
1166985874 19:46659811-46659833 AGGGGAAGACAGACTGAGCCTGG + Intronic
1167112035 19:47468260-47468282 AAGGGGGAACAGCAGGTGCCAGG - Intronic
1167430192 19:49449720-49449742 AAAGGAAAAGAGACAGAGCCTGG - Intronic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1167942090 19:52956043-52956065 AAGAGCAAAGAAAAGGAGCCAGG - Exonic
1167944980 19:52980907-52980929 AAGAGCAAAGAAAAGGAGCCAGG - Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1202635982 1_KI270706v1_random:44838-44860 AATGGAAAACAGAAGAAATCAGG - Intergenic
1202674042 1_KI270710v1_random:24094-24116 AAGGGGTGACAGAAGGAACCTGG - Intergenic
925073625 2:991511-991533 TATGGAAAACAGAATAAGCCAGG - Intronic
925172969 2:1762228-1762250 AATGGAAAACAAAAGAAGGCAGG + Intergenic
925334520 2:3084681-3084703 AATGGAAAACAAAAGAAGGCAGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926194684 2:10755629-10755651 AGGGGCAAACAGTAGGAGCCGGG - Intronic
926384526 2:12323295-12323317 AATGGAAAAAAAAAGGAGCAGGG - Intergenic
927426449 2:22986340-22986362 AATGGAAAACAAAAGAAGGCAGG + Intergenic
927451100 2:23210126-23210148 CATGGAAAACAGTGGGAGCCAGG - Intergenic
927486901 2:23494812-23494834 GAAAGAAGACAGAAGGAGCCCGG - Intronic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928959726 2:36911658-36911680 AAGTGAAGACACAAGGAGGCTGG - Intronic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929451484 2:42040937-42040959 AGGGGAAAAAAGAGGGAGACAGG - Intergenic
929928125 2:46231875-46231897 AAAGGAAAACAGAGGTACCCAGG + Intergenic
929959306 2:46484510-46484532 AAGTGAAAAAAGGAGGTGCCTGG - Intergenic
930092580 2:47541957-47541979 TACAGAAAACAGAATGAGCCAGG - Intronic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930249691 2:49021548-49021570 GAGGGAAAAAAGAAGGCCCCTGG + Intronic
930251087 2:49034718-49034740 AAGGGAATACAGAATGGGGCAGG - Intronic
930368452 2:50473690-50473712 AAGACAACACAGAAGGACCCAGG - Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930801213 2:55444407-55444429 AATGGAAAACAGAAAAAGGCAGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931130361 2:59328611-59328633 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931194414 2:60037166-60037188 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931337651 2:61364374-61364396 AATGTAAAACAGAAGAAACCAGG + Intronic
931486156 2:62694760-62694782 AAGCCAAAACAGAGGAAGCCAGG - Intronic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931562807 2:63581226-63581248 AGGGGAAACCAGGAGTAGCCCGG + Intronic
931819885 2:65941224-65941246 ACCTGAACACAGAAGGAGCCTGG + Intergenic
932529638 2:72515185-72515207 AAGGGAAAAGAGAAGGTCCCAGG + Intronic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933052670 2:77618909-77618931 AATGGAAAACAGAAACAGGCCGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933404616 2:81842233-81842255 AATGGAAAACAAAAGAAGGCAGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935937914 2:108206959-108206981 AATGGAAAACAGAAAAAGGCAGG - Intergenic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
936392352 2:112087063-112087085 GAGGGACAACGGAAGGTGCCAGG - Intronic
936719407 2:115232523-115232545 AAGGGAAATCAGAAGGCACAAGG - Intronic
936942338 2:117898284-117898306 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
937035040 2:118774014-118774036 AAGGGAAAACAGAAGCGGTGAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937507459 2:122552983-122553005 AATGGAAAACAGAAAAAGGCAGG + Intergenic
937549791 2:123073680-123073702 TAGAAATAACAGAAGGAGCCAGG - Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
939240495 2:139552588-139552610 AACGGAAAGCAGAAGGAACTGGG + Intergenic
939696915 2:145337648-145337670 GAGGGAAAACAGAGGGGACCTGG - Intergenic
939975008 2:148707165-148707187 AATGGAAAACAAAAAGAGGCAGG + Intronic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940819103 2:158331830-158331852 AATGGAAAACAGAAAAAGGCAGG - Intronic
940860085 2:158762265-158762287 AAAACAAAACAGAAGAAGCCAGG + Intergenic
941088985 2:161152338-161152360 AAATGAAAGCAGAAGGAGCTTGG - Intronic
942069523 2:172303904-172303926 AGGGCACAACAGGAGGAGCCAGG - Intergenic
942106758 2:172641288-172641310 AAAGGAAAAAAGAATTAGCCAGG - Intergenic
942790494 2:179755756-179755778 AATGGAAAACAGAAAAAGGCAGG - Intronic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
942976854 2:182029036-182029058 AAGGGAAAACAAAAAAAGGCAGG - Intronic
944022175 2:195118827-195118849 AAAAGAAGAAAGAAGGAGCCTGG - Intergenic
944065448 2:195615069-195615091 AAGGGAAAATAGAGGGGGTCTGG + Intronic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
945409056 2:209487887-209487909 AAGGAAAAACAAAAGGAACTTGG + Intronic
945870653 2:215222553-215222575 AAAGGAAAACAGAAAAAGGCAGG + Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946357270 2:219195787-219195809 GAGGGAAAACAAAAGAAGCCAGG + Intronic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946695482 2:222353903-222353925 TAGGGAGAAGAGAAAGAGCCGGG + Intergenic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
947687895 2:232106382-232106404 AATGGAAAACAGAAGAAACCAGG + Intronic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948473868 2:238203876-238203898 AAGGAAAAGCAGGAGGGGCCCGG - Intergenic
948935277 2:241159879-241159901 AAATTAAAAAAGAAGGAGCCAGG + Intronic
1168896256 20:1325734-1325756 AAGGGAGAGCAAAAGCAGCCGGG - Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1170414500 20:16125574-16125596 AAAGGCAAACAGGAAGAGCCGGG - Intergenic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170549343 20:17462976-17462998 AAGGGATACTAGAAGGAACCTGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171080454 20:22177300-22177322 ATGGGAAAGGAGGAGGAGCCAGG - Intergenic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1172393693 20:34583977-34583999 AAGGGAAAACAGACACAGACAGG - Intronic
1172468231 20:35172677-35172699 TAGGGAAAATGGAAGGAGACTGG + Intronic
1172548486 20:35780519-35780541 AAAAGAAAAAAGAATGAGCCAGG - Intronic
1172739532 20:37154959-37154981 AAGGGGACACAGAACCAGCCTGG + Intronic
1172891676 20:38270408-38270430 AAGAGAAAACATAAGAAGTCAGG + Intronic
1172958987 20:38784129-38784151 AAGGGAAAAAAGCAGAAGCTTGG - Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173912550 20:46681072-46681094 AAGGAAGAACGGAAGGGGCCAGG + Intronic
1174107448 20:48172627-48172649 AACACAAAACAGAATGAGCCAGG + Intergenic
1175013769 20:55766150-55766172 AAGGAAAAACAGAAGGTATCAGG - Intergenic
1175167181 20:57053162-57053184 GCAGAAAAACAGAAGGAGCCTGG - Intergenic
1175349479 20:58308718-58308740 ATGGGATAAGAGATGGAGCCGGG + Intergenic
1175531056 20:59674520-59674542 AAGGGGAGACAGAAGAAGCGGGG - Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1176193640 20:63826371-63826393 AAGAGAAACCAAGAGGAGCCCGG + Intronic
1176350208 21:5787438-5787460 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176357022 21:5908022-5908044 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176544529 21:8185508-8185530 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176563480 21:8368553-8368575 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176971996 21:15277231-15277253 AAGGGAAACCAAAATAAGCCTGG - Intergenic
1177025584 21:15918405-15918427 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1177372103 21:20217956-20217978 AAGGAAATTCATAAGGAGCCTGG - Intergenic
1177604823 21:23364198-23364220 AGGGAAAAACAGGAGGAGCAGGG + Intergenic
1178067691 21:28924349-28924371 AAGGGAAAATAAAAGCAGCTGGG + Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1179106696 21:38406879-38406901 AAAGGAAAACTGAATGGGCCAGG - Intronic
1179293811 21:40042967-40042989 TAGTGAAAACAGTAGGAGCCAGG + Intronic
1179451395 21:41470754-41470776 AAGAGAAAACACAGTGAGCCAGG + Intronic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179842774 21:44088020-44088042 ATCGGGAATCAGAAGGAGCCAGG - Intronic
1180364732 22:11928402-11928424 AATGGAAAACAGAAGAAATCAGG + Intergenic
1180606825 22:17065216-17065238 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1180757307 22:18170966-18170988 AAGGGAAAACAGAAAGGACATGG - Intronic
1181074472 22:20366499-20366521 AAGGGAAAACAGAAAGGACATGG + Intronic
1181458200 22:23071177-23071199 AAGGGAAAAAATATTGAGCCGGG - Intronic
1182288388 22:29260893-29260915 AAGGAAAACCAAAAGCAGCCAGG + Intronic
1182463672 22:30500898-30500920 AAGGAAAAACAGAGGGGGTCAGG + Intronic
1182514597 22:30847273-30847295 AAAAGAAAAAAGAATGAGCCTGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183239653 22:36647816-36647838 AAGGAAAAACACAGGGAGCTAGG - Intronic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184544173 22:45154763-45154785 AAGTGAAGGCTGAAGGAGCCAGG - Intergenic
1184806517 22:46798169-46798191 ACAGGAAAACAGAATGGGCCAGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185155764 22:49192534-49192556 GAGGGAAAGCCGCAGGAGCCCGG + Intergenic
1203249399 22_KI270733v1_random:101746-101768 AATGGAAAACAGAAAAAGGCAGG + Intergenic
949121263 3:387366-387388 AAGAAAGAACAAAAGGAGCCAGG - Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949209416 3:1479780-1479802 AATGGAAAACAAAAGTAGGCAGG + Intergenic
949425473 3:3911101-3911123 AACGGAAAACAAAAGAAGGCAGG + Intronic
949600635 3:5594614-5594636 AATGGAAAACAAAAAGAGGCAGG - Intergenic
950453678 3:13079931-13079953 AAGGAAAAACAGAAGTTTCCTGG + Intergenic
951939457 3:28061417-28061439 AATGGAAAACAAAAGAAGGCGGG + Intergenic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
953153077 3:40343103-40343125 AATGGAAAACAAAAGAAGCAGGG - Intergenic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953816326 3:46161105-46161127 AATGGAAAACACAAAAAGCCAGG - Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955005782 3:54967038-54967060 AAGGCAGAGCAGAATGAGCCTGG + Intronic
955568664 3:60278053-60278075 AAGCAAAAACAGAAGGACCTAGG + Intronic
955789331 3:62572244-62572266 ATGAGGAAACAGAAGGACCCAGG - Intronic
956095481 3:65711731-65711753 GAGGGATAACAGCAGGAGTCTGG + Intronic
956215592 3:66845101-66845123 AATGGAAAACAGAAAAAGGCAGG + Intergenic
956265900 3:67395340-67395362 AATGGAAAACAGAAAAAGGCAGG + Intronic
956285150 3:67600835-67600857 AGTGAAAAACAAAAGGAGCCTGG + Intronic
956394681 3:68812492-68812514 AATGGAAAACAAAAGAAGGCAGG + Intronic
956899914 3:73704577-73704599 AGGGGAAAACAGAAGATACCTGG + Intergenic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
957409375 3:79817525-79817547 AAAGGAAGACAGCAAGAGCCTGG - Intergenic
957598619 3:82302103-82302125 AAAAGAAGTCAGAAGGAGCCAGG - Intergenic
957636649 3:82794086-82794108 AAGTGAAAACAGGAGAAGCAAGG + Intergenic
957695671 3:83635719-83635741 AAGGGAAACCATGAGGGGCCTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958190035 3:90173396-90173418 AATGGAAAACAAAAAAAGCCAGG - Intergenic
958208340 3:90434480-90434502 AAAGGAAAACAAAAAGAGGCAGG - Intergenic
958446147 3:94217501-94217523 AATTGAAAACAGAAGAAGCAGGG + Intergenic
958569649 3:95862691-95862713 AATGGAAAACAGAAAAAGGCAGG + Intergenic
959117718 3:102197357-102197379 AAGGGAGACCAGAAGAAGTCTGG - Intronic
959728277 3:109570376-109570398 GAGGGACAACAGAGGAAGCCAGG - Intergenic
959992045 3:112640746-112640768 AAGGGAGATAAGAAGGATCCTGG - Exonic
960318557 3:116207228-116207250 AATGGAAAACAGAAAAAGGCAGG - Intronic
960324480 3:116278496-116278518 AATGGAAAGCAGAAAAAGCCAGG + Intronic
960339516 3:116457497-116457519 AATGGAAAACAGAAAAAGGCAGG + Intronic
960928179 3:122816962-122816984 AAAGGAAAACAGAATGACCCTGG + Intronic
961068672 3:123899541-123899563 AAGGGAATGCAGAAAGACCCAGG - Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962397410 3:135029049-135029071 AAGGGAAAACAAAAAAAGGCAGG - Intronic
962424272 3:135256042-135256064 AATGGAAAACAAAAGAAGGCAGG - Intronic
962666914 3:137662881-137662903 AATGGAAAACAAAAAAAGCCAGG + Intergenic
962705991 3:138045213-138045235 AAGGCAGAACAAAAGGAGCCTGG + Intergenic
962836536 3:139194469-139194491 AATGGAAAACAGAAAAAGGCAGG - Intronic
963057359 3:141196769-141196791 AATGGAAAACAGAAGAAAACAGG + Intergenic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963835576 3:150055178-150055200 GAGGGAAAACAGAAAAGGCCTGG + Intergenic
964463915 3:156968443-156968465 AATGGAAAACAAAAGAAGGCAGG + Intronic
964503811 3:157376723-157376745 AATGGAAAACTGAAGCAGACAGG - Intronic
964564675 3:158036444-158036466 AATGGAAAACAGAAAAAGGCAGG + Intergenic
965271290 3:166619736-166619758 AATGGAAAACAGAAAAAGGCAGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966977667 3:185099880-185099902 AATGGAAAACAGAAAAAGCAGGG + Intronic
967492832 3:190113224-190113246 AAGGGAAAGCAAATGGAGCTTGG - Intronic
967502851 3:190220437-190220459 AATGGAAAACAGAAAGAAGCAGG - Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
968284997 3:197503311-197503333 AAGAGAAAACACAGGAAGCCAGG + Intergenic
968897103 4:3410819-3410841 AAAGGAAAACAGAAGGGTACAGG - Intronic
969269426 4:6089045-6089067 AAAGAAAAACAGGAGGATCCTGG - Intronic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
970022093 4:11581203-11581225 AAGGGAAAACAAAAAAAGGCAGG - Intergenic
970436093 4:16036978-16037000 AAGGAAAGAGAGCAGGAGCCAGG + Intronic
970674921 4:18438223-18438245 AAAAAAAAAAAGAAGGAGCCTGG - Intergenic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971738950 4:30496180-30496202 GAGGCAAAATAGAAGCAGCCTGG - Intergenic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974238210 4:59208770-59208792 AATGGAAAACAAAAAGAGGCAGG + Intergenic
974427360 4:61758503-61758525 AATGGAAAACAGAAAAAGGCAGG - Intronic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
974780576 4:66547380-66547402 AATGGAAAACAGAAAAAGGCAGG + Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
974927363 4:68316796-68316818 AAGGGAAAACTGAAGCAACAAGG + Intronic
975319560 4:72994899-72994921 AAGGGAAAACACAAGGTTCTGGG - Intergenic
976104159 4:81599102-81599124 AAAGGGAAACTGAAGGAGCCAGG - Intronic
976332217 4:83845469-83845491 AGGGGATGACAGAAGGAACCAGG + Intergenic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
977836287 4:101649199-101649221 AAGGAAAAAGAGAAGTAGCGTGG + Intronic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
978216885 4:106215533-106215555 AAGGGAAAACAAAAAAAGGCAGG + Intronic
978542351 4:109831616-109831638 ATAGGAAAAGAGAAGGAGCAGGG + Intronic
978599796 4:110415922-110415944 AAGAGCAAAGAAAAGGAGCCAGG + Intronic
978938694 4:114411509-114411531 AATAGAAAATAGTAGGAGCCTGG + Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980877096 4:138672591-138672613 AGGGGAAAACAGAAGCAAACTGG - Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
981556544 4:146001578-146001600 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981607587 4:146556759-146556781 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981881963 4:149624929-149624951 AAAGGGAAACAGAACGAGCTTGG - Intergenic
982079182 4:151770857-151770879 AAGGAAAAAAAGAAGGATCAAGG + Intergenic
982566416 4:156992501-156992523 AGGGGAAAGCAAAAGGAGCAAGG + Intergenic
983222936 4:165060105-165060127 AAGAGAAAACAAAAGGTTCCTGG + Intergenic
984038136 4:174693905-174693927 AACGGAAAACAGAAAAAGCAAGG + Intronic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985141033 4:186840675-186840697 AAGGGAGGAGAGAAGGAGTCGGG - Intergenic
1202763301 4_GL000008v2_random:130701-130723 AATGGAAAACAGAAGAAATCAGG - Intergenic
985936968 5:3104825-3104847 AAGGGAAACAGGAAGGGGCCAGG - Intergenic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
987117110 5:14734543-14734565 CAGTGAAAACCGAAAGAGCCGGG + Intronic
987264403 5:16236838-16236860 GAGGGAAAACAGAAACTGCCAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988985952 5:36619139-36619161 AAAGGACAAAAGAATGAGCCAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989528543 5:42480711-42480733 AATGGAAAACAGAAAAAGGCAGG - Intronic
989608007 5:43264445-43264467 AATGGAAAACAGAAAAAGGCAGG - Intronic
989693043 5:44168842-44168864 AATGGAAAACAAAAAGAGCAGGG - Intergenic
990308291 5:54515303-54515325 ACCGGAAGACAGAGGGAGCCTGG - Intergenic
990555823 5:56934720-56934742 AAAGGAAAAAAGAAGGACTCAGG + Intronic
990648254 5:57869186-57869208 AATGGAAAACAGAAAAAGGCAGG - Intergenic
990763402 5:59155693-59155715 AAAGGAAAACAGACGAAGCAAGG + Intronic
991037263 5:62140366-62140388 AAAGGACAACAGATGGAACCAGG + Intergenic
991247791 5:64526190-64526212 AAAGGAAAACAGGAGGGGCAAGG + Intronic
991409588 5:66332936-66332958 AAGGGAGAACAGAAGCAGTGAGG - Intergenic
992273013 5:75085352-75085374 AAAAGAAAAGAAAAGGAGCCGGG - Intronic
994238678 5:97394317-97394339 TATGGAAAACAGAAAGAGTCAGG - Intergenic
994290626 5:98024919-98024941 AATGGAAAACAAAAAGAGGCAGG + Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
996010238 5:118474307-118474329 AAAGGGAAAGAGAATGAGCCTGG - Intergenic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996306263 5:122051580-122051602 AATGGAAAACAGAAAAAGCAGGG - Intronic
996613304 5:125410353-125410375 AAAATGAAACAGAAGGAGCCAGG + Intergenic
997015699 5:129931922-129931944 AAGGGAAAGGAGAAGGATCTTGG + Intronic
997065938 5:130558664-130558686 AATGGAAAACAGAAAAAGGCAGG + Intergenic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998115405 5:139533353-139533375 AAAGGAAAAGAAAAGGGGCCGGG + Intronic
998167908 5:139855041-139855063 AAGTGAACAGAGAGGGAGCCGGG - Intronic
998241939 5:140454031-140454053 AATGGAAAACAGAAAAAGGCAGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
1000114248 5:158138458-158138480 AAGGGAAGACAGAAAGTGCCAGG - Intergenic
1000509814 5:162166589-162166611 AAAGGAAAACAGAAAAAACCAGG + Intergenic
1001065559 5:168532621-168532643 AGGGGAAGACAGAAGCAGCTGGG + Intergenic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002207573 5:177574170-177574192 AAGAGAAAATAGAAGAAGCCAGG - Intergenic
1002405991 5:179031979-179032001 AGGGGACAACAGGAAGAGCCAGG - Intronic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005615260 6:27566585-27566607 GAGGGACAAGAGCAGGAGCCTGG + Intergenic
1005734091 6:28729374-28729396 AATGGACAACTGGAGGAGCCGGG - Intergenic
1005960826 6:30691793-30691815 AAGGGAAAACATAAGATGTCTGG - Intergenic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006435568 6:34024301-34024323 AAGGGAAAAGAGAAGACGCATGG - Intronic
1007338246 6:41170864-41170886 AAGGGACATCAAAAGGAGCTTGG + Intergenic
1007480906 6:42149208-42149230 AGAGGAAAACAGAGGTAGCCGGG - Intergenic
1008032860 6:46716724-46716746 AAAGGAAAATACAAGCAGCCTGG + Intronic
1008073200 6:47118320-47118342 AAGGGAAAAAAAAAGGATCCTGG - Intergenic
1008193760 6:48493132-48493154 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1008212280 6:48739526-48739548 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008412025 6:51191487-51191509 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009677724 6:66847741-66847763 AAGGGAAAAAGGAAGAAGCTAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009917789 6:70017618-70017640 AAGGGAAAACATAAGAAGCTGGG + Intronic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010368091 6:75076076-75076098 AAGGGAAAAGAAAAGGAAACAGG + Intergenic
1010463596 6:76141553-76141575 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010981003 6:82369458-82369480 AAGGAAAAAGAGTAGGAGCTTGG + Exonic
1011300160 6:85865248-85865270 AAGGGAAATCAGAAAGAAACAGG - Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012540572 6:100356886-100356908 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1012845312 6:104381045-104381067 AAGGGAAAGCAGCAAGAGTCTGG + Intergenic
1012969966 6:105718433-105718455 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1013134887 6:107272477-107272499 ACAGTAAGACAGAAGGAGCCTGG + Intronic
1013276106 6:108586300-108586322 AAATGAAAACAGAAGTAGCGTGG + Intronic
1014464287 6:121736849-121736871 AATGGAAAACAGAAAGAAGCAGG - Intergenic
1014881441 6:126728559-126728581 AATGGAAAACAAAAAAAGCCAGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015392998 6:132703879-132703901 AATGGAAAACAAAAGGAGCAGGG + Intronic
1016911953 6:149208047-149208069 GAGGGAGAACCGAAGAAGCCAGG + Intergenic
1017187763 6:151619357-151619379 AATGGAAAACAGAAAGTGACAGG - Exonic
1017293414 6:152767430-152767452 AAGGCAAAAGAGAAGGACCAAGG - Intergenic
1018036924 6:159889572-159889594 AAGGCAGAAAAGAAGGAGCACGG - Intergenic
1018791430 6:167151229-167151251 AAGAGAAAGCACAAGGGGCCAGG + Intronic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1020656970 7:10939981-10940003 AAGGGAAAACATTAGGAGAGCGG + Intronic
1020702501 7:11500642-11500664 AAAGAAAAAAAGAAGGGGCCGGG + Intronic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021418584 7:20419151-20419173 AATGGAGAGGAGAAGGAGCCAGG + Intergenic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022018042 7:26369689-26369711 AGATGAAAAGAGAAGGAGCCAGG - Intronic
1022352881 7:29582113-29582135 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1023906288 7:44524053-44524075 AAGGGAAAAATGAAGGTGTCGGG - Intronic
1024542155 7:50484810-50484832 AAAAGAAAACGTAAGGAGCCAGG - Intronic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1024723450 7:52165361-52165383 AAGGGAAAACTGCAGGAGAGTGG - Intergenic
1025591107 7:62861090-62861112 AATGCAAAACAAAAGAAGCCAGG + Intergenic
1025856604 7:65285827-65285849 AAGGGAAAGAAGAGGTAGCCTGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026366882 7:69657109-69657131 AGGGGAAAGCTGAAGGAGCCGGG - Intronic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026942141 7:74293364-74293386 AGGGGAAAGGAGAAGGAGACGGG - Intronic
1027159400 7:75791408-75791430 GAGGGAAGAGAGCAGGAGCCAGG - Intergenic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1027447424 7:78290270-78290292 AATGGAAAACAAAAAGAGCAGGG + Intronic
1027765834 7:82340296-82340318 AAGCGAACTCAGGAGGAGCCTGG - Intronic
1027846814 7:83388742-83388764 AAGGGAGGACACAAAGAGCCAGG - Intronic
1028077178 7:86531450-86531472 AATGGAAAACAGAATAAGCAGGG - Intergenic
1028562126 7:92187565-92187587 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029101663 7:98136034-98136056 TAGGGAAAATATGAGGAGCCTGG + Intronic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1029916211 7:104212049-104212071 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1030344278 7:108415171-108415193 AAGGGAAACCAGAAGGCTCAGGG - Intronic
1030691957 7:112545268-112545290 AATGGAAAACAGAAAAAACCAGG - Intergenic
1031584349 7:123516793-123516815 TAGGGAAAACACAAGGTGGCTGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1033039071 7:137901890-137901912 AAAGAAAAATAGAAGGAGCTGGG + Intronic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1034817270 7:154183362-154183384 AATGAAAAACAGAAGGTGCCTGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035840016 8:2801174-2801196 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1037232240 8:16672293-16672315 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1037546902 8:19932462-19932484 AATGGAAAACAGAAAAAGGCAGG + Intronic
1037801785 8:22039996-22040018 AAGGGAACTGAGAAGTAGCCTGG - Intergenic
1038166527 8:25090248-25090270 AAGGGAAAAAAGATGGGGCTTGG + Intergenic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038930029 8:32183348-32183370 AGAGGAAGACAGAAGGAGACGGG - Intronic
1038963682 8:32548760-32548782 AAGGGCAAGAAGAAGGAGCGAGG + Exonic
1039097344 8:33900870-33900892 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039271649 8:35887839-35887861 AAGGGAAAAAGGAAGGACCATGG + Intergenic
1039718970 8:40142017-40142039 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040094028 8:43426029-43426051 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1040458499 8:47623555-47623577 AATGGAAAACAGAAAAAGGCAGG + Intronic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041091007 8:54300541-54300563 AAGGGAAAAAAGAATGTTCCAGG - Intergenic
1041440980 8:57896754-57896776 AAAGGTAAAGAGAAGTAGCCAGG - Intergenic
1041562015 8:59228550-59228572 AATGGAAAACAGAAAAAGCAGGG + Intergenic
1041614001 8:59884160-59884182 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041732401 8:61075849-61075871 AAGGGAAGAAGGAAGGAGGCTGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041889520 8:62853278-62853300 AATGGAAAACAAAAGAAGGCAGG - Intronic
1041974172 8:63778004-63778026 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1042010779 8:64242276-64242298 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1042016618 8:64320545-64320567 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1043870081 8:85422670-85422692 AATGGAAAACAGAAAAAGGCAGG - Intronic
1044127550 8:88476534-88476556 AATGGAAAACAGAAAAAGCTGGG + Intergenic
1044203167 8:89459819-89459841 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1044284618 8:90397206-90397228 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1044353646 8:91195668-91195690 AATGGAAAACAGAAAAAGGCAGG - Intronic
1044451686 8:92342883-92342905 AAGTGAAAACAGACTGAGCCTGG - Intergenic
1044866737 8:96578527-96578549 AAGAGAAACCAGAATCAGCCTGG - Intronic
1045119012 8:99015106-99015128 AAGAGGAAAAAGAAGCAGCCAGG - Intronic
1045293648 8:100854621-100854643 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1046221829 8:111226788-111226810 AAGGGAAAAGAGAGGGAGTTTGG - Intergenic
1047586693 8:126281097-126281119 ACGGGAATACAGCAGGAGCCTGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048161085 8:132022725-132022747 AAGGGAGGGAAGAAGGAGCCAGG + Intergenic
1048163947 8:132045553-132045575 AAGGGAAACCAGGAGAAGGCAGG - Intronic
1048195768 8:132330650-132330672 AAGGCAAAACATTAGGAGCTGGG + Intronic
1048266871 8:132995061-132995083 ACAGGCAAGCAGAAGGAGCCAGG + Intronic
1048437361 8:134431056-134431078 AAAGAAAAACATAAGGAGCATGG + Intergenic
1048682413 8:136858192-136858214 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049356455 8:142191510-142191532 AAGGGAAGAAAGCGGGAGCCTGG - Intergenic
1050047341 9:1560734-1560756 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1050048333 9:1572845-1572867 AAGGGAAAACATAAAAAGGCAGG - Intergenic
1050167314 9:2778956-2778978 AATGGAAAGTAGGAGGAGCCGGG - Intronic
1050266171 9:3892244-3892266 AAGGCAAAAAAAAAGCAGCCTGG + Intronic
1050617319 9:7415775-7415797 AAGTGAAAACAGCAAAAGCCTGG + Intergenic
1051228416 9:14927555-14927577 TAAGGAAAACAGAAGGCGTCAGG - Intergenic
1051262214 9:15275656-15275678 AAGGGAGGACATAAGGAGCTTGG + Intronic
1051324560 9:15950941-15950963 AATGGAAAACAAAAAGAGGCAGG + Intronic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051654803 9:19369233-19369255 CAGGTACAACAGAAGGAACCTGG - Intronic
1052429702 9:28350317-28350339 AATGGAAAACAAAAGAAGGCAGG + Intronic
1052451731 9:28639644-28639666 AATGGAAAACAAAAGAAGGCAGG - Intronic
1052658207 9:31392463-31392485 AAGGGAAAACAGTAAGGGCCAGG - Intergenic
1053039172 9:34855097-34855119 AATGGAAAACAGAAAAAACCAGG - Intergenic
1053089191 9:35258316-35258338 AAGGCAAAACAGAAAGAGAAAGG - Intronic
1053521239 9:38781668-38781690 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1054193402 9:62005661-62005683 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1054645006 9:67583030-67583052 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1055232009 9:74077583-74077605 AAGGAAAATCAGCAGGAGTCTGG + Intergenic
1055512854 9:77012368-77012390 AACCCAAAACAGAAGGAGCAGGG + Intergenic
1055556744 9:77481873-77481895 AATGGAAAACAGAAAAAGGCAGG - Intronic
1056376884 9:86023446-86023468 AGAGGAAAACAGAATGAGCATGG + Intergenic
1056588113 9:87941646-87941668 GAGGGAAAAAATGAGGAGCCTGG + Intergenic
1056608753 9:88111299-88111321 GAGGGAAAAAACGAGGAGCCTGG - Intergenic
1056637393 9:88342600-88342622 AAGGAAATAGAGAAGTAGCCTGG - Intergenic
1056788107 9:89606742-89606764 AAAGGAGAAAAGTAGGAGCCAGG - Intergenic
1057226955 9:93297496-93297518 AAGGGAAATCAGCAGGTGCCAGG - Intronic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1057567018 9:96173793-96173815 AAGGGAAACCGAAAGGTGCCAGG - Intergenic
1058063782 9:100526980-100527002 AAGGGAAAAAAAAATTAGCCGGG + Intronic
1058263873 9:102873390-102873412 AGGGGAAAATGGAAGGAGTCAGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059846059 9:118278211-118278233 AAGAGAATTCAGAAGGAACCAGG + Intergenic
1059984173 9:119805850-119805872 AAGGGAAATTAGTAGGAACCAGG - Intergenic
1061316564 9:129799911-129799933 AGGGGAAATGAGAAGGAGCATGG - Intergenic
1061547626 9:131313908-131313930 AAGGGAAAAAAAAATTAGCCGGG - Intergenic
1061995791 9:134182151-134182173 GAGAGAAAAAAAAAGGAGCCGGG + Intergenic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1062319672 9:135984632-135984654 AAGGGGCCTCAGAAGGAGCCTGG - Intergenic
1203440854 Un_GL000219v1:7203-7225 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203465795 Un_GL000220v1:85006-85028 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1203511732 Un_KI270741v1:125586-125608 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203511861 Un_KI270741v1:127214-127236 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203544063 Un_KI270743v1:115572-115594 AATGGAAAACAGAAGAAATCAGG - Intergenic
1186101663 X:6163925-6163947 CAAGGAAACCAGAAGGAACCAGG + Intronic
1186140269 X:6564464-6564486 AAAGGAAAAGAGAGGGATCCAGG + Intergenic
1186164491 X:6811968-6811990 AAGAGAAAATAGAAGGTACCAGG + Intergenic
1186931246 X:14393134-14393156 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1187222841 X:17346304-17346326 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1188494713 X:30771588-30771610 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1188628741 X:32323483-32323505 AAGTGAAAACAATAGTAGCCAGG + Intronic
1188778494 X:34251709-34251731 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1188815558 X:34708927-34708949 AAGTCAAAACAAAAAGAGCCTGG + Intergenic
1188922314 X:35992134-35992156 AAGGGAAAAGAGAAGAAACAGGG - Intergenic
1188981841 X:36733741-36733763 AAGGCAAAACAGGAGAAGCCTGG - Intergenic
1189571343 X:42301160-42301182 AAGGAAGAACACAAGCAGCCTGG - Intergenic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1191050528 X:56186193-56186215 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1191110612 X:56800814-56800836 TAAGGAAATCAGAAGGACCCGGG + Intergenic
1191137862 X:57085035-57085057 AATGGAAAACAGAAAGAAGCAGG + Intergenic
1191707771 X:64112561-64112583 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1191828059 X:65387464-65387486 AATGGAAAACAGAAAAAGGCAGG - Intronic
1191961322 X:66705934-66705956 AATGTAAAACAGAAGGAAACCGG - Intergenic
1192077224 X:68011476-68011498 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1192918820 X:75684211-75684233 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1193059213 X:77186769-77186791 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1193344826 X:80393359-80393381 ACGGGAAAAAAGAAGGAGTGAGG - Intronic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1193923332 X:87455980-87456002 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1194231950 X:91335376-91335398 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194465740 X:94233453-94233475 AATGGAAAACAGAAAAAACCAGG - Intergenic
1194900214 X:99500225-99500247 AATGGAAAACAGAAAAAGCAGGG + Intergenic
1195092364 X:101473125-101473147 AATGGAAAACAAAAAGAGGCAGG + Intronic
1195104493 X:101591102-101591124 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195147698 X:102033744-102033766 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195832070 X:109070448-109070470 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1196414652 X:115458012-115458034 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1196736604 X:118986203-118986225 AAGGGAAACCAGCAAGAGACTGG + Intronic
1197543174 X:127791079-127791101 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198131590 X:133701003-133701025 AAGGGAGGAAAGAAGGAGACAGG - Intronic
1198796246 X:140398853-140398875 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1198838709 X:140833068-140833090 AAAGGAAAACAGCAGCAGCTGGG + Intergenic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1199465096 X:148127294-148127316 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1200838947 Y:7760849-7760871 AGGGGAAAATATAAGGAGCAAGG + Intergenic
1201171809 Y:11273882-11273904 AAGGGGTAACAGATGGAACCTGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201494059 Y:14574417-14574439 AATGGAAAACAAAAAAAGCCAGG - Intronic
1201558591 Y:15290933-15290955 AAGAGAAAATAGAAGGTGCCAGG + Intergenic
1201621600 Y:15965105-15965127 AAAGGAAATCAGAGGGAGACAGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic
1201991635 Y:20033255-20033277 AATGGAAAACAAAAAAAGCCAGG + Intergenic