ID: 1101499840

View in Genome Browser
Species Human (GRCh38)
Location 12:105292934-105292956
Sequence TGCCAACTAGAACTCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101499840_1101499846 30 Left 1101499840 12:105292934-105292956 CCACTTTGGAGTTCTAGTTGGCA 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1101499846 12:105292987-105293009 CTTTGGGTTTAATGTGTCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 282
1101499840_1101499845 14 Left 1101499840 12:105292934-105292956 CCACTTTGGAGTTCTAGTTGGCA 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1101499845 12:105292971-105292993 TACAGCTTCATATTTACTTTGGG 0: 1
1: 0
2: 3
3: 28
4: 271
1101499840_1101499844 13 Left 1101499840 12:105292934-105292956 CCACTTTGGAGTTCTAGTTGGCA 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1101499844 12:105292970-105292992 ATACAGCTTCATATTTACTTTGG 0: 1
1: 0
2: 1
3: 20
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101499840 Original CRISPR TGCCAACTAGAACTCCAAAG TGG (reversed) Intronic
900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG + Intronic
900703632 1:4062786-4062808 TGCCAAGTTGAAGTCCACAGTGG - Intergenic
902794296 1:18791061-18791083 TGCCAACTGGAGCTCCTCAGTGG - Intergenic
903976613 1:27154510-27154532 TGCAATCTGGAACTCCAAAGTGG + Exonic
907695786 1:56727270-56727292 TGCCAACTTGTTTTCCAAAGTGG - Intronic
907713337 1:56904792-56904814 TGCCATCTAAGACCCCAAAGAGG - Intronic
910655489 1:89614211-89614233 TGCCAATTAGAAGTCCAGACGGG - Intergenic
911554871 1:99331290-99331312 TGCCAAACAGTTCTCCAAAGTGG - Intergenic
912515472 1:110213995-110214017 TGCCACCTGGAATTCCAGAGGGG - Intronic
916884430 1:169053158-169053180 TGCCAATTAGAAATCCAAAGCGG + Intergenic
917180800 1:172295207-172295229 TGACAACCAGAAATCCAGAGAGG + Intronic
917500549 1:175581175-175581197 TGTCAACTAGAACTGAAAATGGG + Intronic
918732681 1:188018110-188018132 TACCAACCATAACTCTAAAGTGG + Intergenic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
919435956 1:197561361-197561383 AGCCAACAAGAATACCAAAGAGG - Intronic
924035251 1:239929888-239929910 GGTCAACAAGACCTCCAAAGAGG + Intergenic
924136994 1:240978103-240978125 TGCCAACTCCAGCTGCAAAGTGG + Intronic
1065203288 10:23334604-23334626 TGCCAAGTATAACTCCAAGCTGG + Intronic
1065585111 10:27210327-27210349 TGCCAAGTTAAACCCCAAAGAGG + Intronic
1066174986 10:32894046-32894068 TGCCAACTTGTTTTCCAAAGTGG + Intergenic
1067672093 10:48332835-48332857 TGCCTACTTAAAATCCAAAGTGG - Intronic
1069762991 10:70828146-70828168 TGCCAAACAGATTTCCAAAGTGG + Intronic
1071685387 10:87749416-87749438 TGCCAATTAGTACGGCAAAGTGG + Intergenic
1072882907 10:99246295-99246317 TGCCACCTTGAGATCCAAAGAGG + Intergenic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1075580469 10:123614033-123614055 AGCCAAGTAAAACCCCAAAGTGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079467938 11:20750012-20750034 CGCCAACGAGTTCTCCAAAGTGG + Intronic
1080162337 11:29192054-29192076 TGCCAGACAGAACTCCACAGAGG - Intergenic
1080242111 11:30138293-30138315 AGCAAATTAGAAATCCAAAGGGG - Intergenic
1082441148 11:52813786-52813808 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082547810 11:54355066-54355088 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082547971 11:54357114-54357136 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082549295 11:54374515-54374537 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082552499 11:54417512-54417534 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1086903323 11:92391824-92391846 TGCCAAATATAACTCCATAAAGG - Intronic
1087263059 11:96032194-96032216 TGCCAACCTGTTCTCCAAAGTGG - Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1091438421 12:493487-493509 TGCCAAACTGAATTCCAAAGTGG - Intronic
1097704946 12:62858417-62858439 TGCCAAGTGTAACTGCAAAGAGG + Intronic
1099378976 12:81932908-81932930 TGCCAAATTGTATTCCAAAGTGG + Intergenic
1099470481 12:83042005-83042027 TGCAAACAAGAACCTCAAAGTGG - Intronic
1100113410 12:91272790-91272812 TGACAACAAGAAATTCAAAGGGG + Intergenic
1100708141 12:97224301-97224323 TCATAACTAGAACTCCAAGGGGG - Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1101906591 12:108831347-108831369 TGCCAACGAGCATTCCAAAAAGG + Intronic
1102333223 12:112054078-112054100 TGTCAACTTCAACTGCAAAGCGG + Intronic
1103123690 12:118402516-118402538 TGCCAACTAGAATTCTGAATTGG + Intronic
1104681348 12:130754189-130754211 TGCCAAATAGTTTTCCAAAGTGG + Intergenic
1106025412 13:25951047-25951069 AGCCAAAGAGATCTCCAAAGTGG - Intronic
1106078183 13:26478745-26478767 TGCCAACAAGTTTTCCAAAGTGG + Intergenic
1106501043 13:30329286-30329308 TGCCAAACAGCTCTCCAAAGTGG + Intergenic
1110371360 13:74744164-74744186 TGCCAACAACATCTCTAAAGGGG - Intergenic
1115643942 14:35353951-35353973 TGCCAAATGGCTCTCCAAAGAGG - Intergenic
1116035853 14:39626663-39626685 TGCCAAATAGTTTTCCAAAGTGG + Intergenic
1117042981 14:51784763-51784785 TGCCATCAACAACTCCAAGGAGG - Intergenic
1118365984 14:65096544-65096566 TGCAAACTAGTCCTCCAATGGGG - Intronic
1118790798 14:69090727-69090749 TGCCAAAAATAACTCTAAAGAGG + Intronic
1119507022 14:75181827-75181849 TGCCAAATTGCTCTCCAAAGGGG - Intergenic
1119801803 14:77451908-77451930 TGCCAAATTGACCTCCACAGGGG - Intronic
1119957610 14:78816726-78816748 TACCAAATTGCACTCCAAAGAGG + Intronic
1120150926 14:81032744-81032766 TGCCACCAAGAATTCCAAATTGG + Intronic
1120670198 14:87354208-87354230 TGTCAACTTGAACTGAAAAGTGG + Intergenic
1123136913 14:106036387-106036409 TGCAAATTAAAACTGCAAAGAGG - Intergenic
1126746781 15:51833875-51833897 TGCCAAACAGTTCTCCAAAGTGG + Intronic
1127250401 15:57230060-57230082 TCCCAATTCGAAGTCCAAAGAGG + Intronic
1127543362 15:59965481-59965503 TGCCACCAAGAATTCCAAATGGG + Intergenic
1129222783 15:74142425-74142447 TGCCAAATATTTCTCCAAAGTGG - Intergenic
1130645348 15:85720831-85720853 TGCCAGGTAGAACTACAAAGGGG + Intronic
1133425567 16:5685766-5685788 TGCCAACTTGTTCTGCAAAGAGG - Intergenic
1134273740 16:12757384-12757406 TGCCTACCAGAACTGCACAGGGG + Intronic
1137341105 16:47606665-47606687 TGACAACTTGCACTCCAAGGAGG + Intronic
1137476423 16:48813442-48813464 GGCCTACTACAACTTCAAAGTGG + Intergenic
1138054445 16:53817304-53817326 TGCAAACTAGAGCTCCAGAAGGG - Intronic
1141289358 16:82703476-82703498 TGTCAAATACATCTCCAAAGGGG - Intronic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1142559917 17:803717-803739 TGCCAAGTACAAAGCCAAAGAGG - Exonic
1143212490 17:5198960-5198982 TGCCAAATTGCTCTCCAAAGTGG + Intergenic
1144298058 17:13898108-13898130 AGCCAAATAGATTTCCAAAGCGG - Intergenic
1145439912 17:23091006-23091028 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1146938881 17:36829791-36829813 TGCCAAATGGCTCTCCAAAGAGG - Intergenic
1148761062 17:50000771-50000793 TGCCAAGCAGTTCTCCAAAGTGG + Intergenic
1149590380 17:57824893-57824915 TGCCAAGTTGCACTCCAGAGTGG - Intergenic
1150319484 17:64200475-64200497 AGCCAGCAAGAACTCCACAGTGG - Intronic
1152567165 17:81105463-81105485 TGACTTCTAGAACTCCAAACTGG - Intronic
1153434066 18:5049489-5049511 TGCCAAATAGACCTTCAAAGTGG - Intergenic
1153578142 18:6543556-6543578 TGCCCACTAGTAATTCAAAGGGG + Intronic
1154162023 18:11987793-11987815 TGCCAAGTAGTTCTCTAAAGAGG + Intronic
1159333255 18:67029548-67029570 AGCCAATTAGAATTCAAAAGTGG - Intergenic
1159705478 18:71680513-71680535 TACAAAGTAGAACTCCATAGAGG + Intergenic
1159764876 18:72476727-72476749 TGACAACAAGAACTACAAATAGG - Intergenic
1159892993 18:73970152-73970174 TGCCAAGTAGTTTTCCAAAGTGG - Intergenic
1164615330 19:29664084-29664106 TGCCAAATAGAACTCCACCTGGG - Intergenic
1164737131 19:30549800-30549822 TGCCATCTAGAACTTGAAGGGGG + Intronic
1166619699 19:44285162-44285184 TGCAAACCAGACCTCCAAATGGG + Intronic
928986883 2:37190802-37190824 TGCCAGCCAGACCTCCAAACAGG - Intronic
929446628 2:42007062-42007084 TGCCAAGTAGTTTTCCAAAGAGG - Intergenic
929767989 2:44866393-44866415 TGCCTAGTTGATCTCCAAAGTGG - Intergenic
932164688 2:69495252-69495274 TGGCAACTTGAACTCCAACTGGG + Intronic
932171552 2:69562149-69562171 TGCCAAGCAGTACTCCACAGTGG + Intronic
933611483 2:84440466-84440488 TGCCAAATAGTTCTGCAAAGTGG - Intronic
934138973 2:89027016-89027038 TGACAACTTGAACTCCAAAATGG + Intergenic
934230272 2:90173545-90173567 TGACAACTTGAACTCCAAAATGG - Intergenic
935451052 2:103209813-103209835 TGCCAAAATGCACTCCAAAGTGG + Intergenic
937300519 2:120836847-120836869 TGCCAAATTGCTCTCCAAAGTGG + Intronic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
940816956 2:158307469-158307491 TGCCAAATAGTTTTCCAAAGTGG - Intronic
941365349 2:164604148-164604170 TGCCAAATTGCTCTCCAAAGTGG - Intronic
942539358 2:176999431-176999453 TTCTAACTATAAATCCAAAGTGG + Intergenic
947886067 2:233572743-233572765 TGCCAAATAATATTCCAAAGTGG - Intergenic
948263204 2:236619514-236619536 TGCCAACTGGAATTCTGAAGTGG + Intergenic
948367263 2:237465096-237465118 GGGCAGCTAGAACTCCAGAGGGG - Intergenic
1169041403 20:2498474-2498496 TGCCAAGTAGAAAACCACAGAGG + Intronic
1169876336 20:10301179-10301201 TGAGAACTAGAAATTCAAAGTGG - Intronic
1171961163 20:31495770-31495792 TGCCAAATTGCCCTCCAAAGGGG + Intergenic
1173355679 20:42287019-42287041 TGCCAATTAAAACTACAATGAGG + Intronic
1175370549 20:58486098-58486120 TGCCAACTCTTACTCCATAGTGG - Intronic
1177844133 21:26268779-26268801 AGCCACCTAGAACACCTAAGAGG - Intergenic
1178114464 21:29403406-29403428 TGCAAAATTGATCTCCAAAGTGG - Intronic
1178779063 21:35582092-35582114 TGCTAACTTCAACTCCAAACTGG + Intronic
1182051963 22:27319515-27319537 TGAAAAATAGATCTCCAAAGTGG + Intergenic
1183417786 22:37692431-37692453 TGCCAGCTAGAACTCCACAAGGG + Exonic
949532815 3:4974143-4974165 TGCCAAACAGATCTCCAAAGAGG - Intergenic
952182547 3:30933456-30933478 TGCCAACTTGGCTTCCAAAGTGG + Intergenic
952701781 3:36336182-36336204 TCCCCACTAGAACTGTAAAGTGG + Intergenic
953150871 3:40323166-40323188 GGCCAATTAGAACCCCATAGTGG + Intergenic
955264148 3:57425072-57425094 TGCAAAGTAGCACTTCAAAGAGG + Intronic
955338293 3:58105080-58105102 GGCCAACTTGAACTTCAAAGGGG - Exonic
955944341 3:64177972-64177994 TGCCAAACAGTGCTCCAAAGTGG + Intronic
955957136 3:64302552-64302574 TGGCAACTAGAATCACAAAGAGG + Intronic
960167691 3:114422298-114422320 TGGCAGCAACAACTCCAAAGGGG - Intronic
964096682 3:152940036-152940058 AGCCAACTAGAAATCAAGAGTGG - Intergenic
964354471 3:155837461-155837483 TGCCAAATAGTTTTCCAAAGTGG - Intronic
969138502 4:5050293-5050315 TGCAGATAAGAACTCCAAAGTGG + Intergenic
970802062 4:19984424-19984446 TGCAAAATAAAACTCCAATGAGG - Intergenic
972682824 4:41323473-41323495 TGCTAACTTGCTCTCCAAAGTGG + Intergenic
972903530 4:43715508-43715530 TGCCAAATGGCCCTCCAAAGAGG - Intergenic
977533189 4:98224628-98224650 TGGAAATTAGAAGTCCAAAGTGG - Intergenic
979554988 4:122035351-122035373 TGCCAAACAGGTCTCCAAAGTGG - Intergenic
983818591 4:172164997-172165019 TGCCAAAGAGGATTCCAAAGAGG + Intronic
984580841 4:181508363-181508385 TTCACACTGGAACTCCAAAGAGG + Intergenic
985143882 4:186872887-186872909 TGCTAAATAGTACTTCAAAGTGG + Intergenic
992608170 5:78483058-78483080 TTCCAAATAAAACTCCAAAAGGG - Intergenic
993521939 5:88913729-88913751 AGTCCAATAGAACTCCAAAGAGG - Intergenic
994760921 5:103852853-103852875 TGCATACTAGATCTCCACAGTGG + Intergenic
996758018 5:126955408-126955430 TGCCAACTTGCTTTCCAAAGTGG + Intronic
997117599 5:131142059-131142081 TGCCAAGTTGTCCTCCAAAGGGG - Intergenic
997344188 5:133173932-133173954 TGCCAAATTGCTCTCCAAAGTGG + Intergenic
998766673 5:145496258-145496280 TGCCCACTAGACATCCAAATAGG + Intronic
1000494907 5:161970289-161970311 TGCAAATTAGAAATACAAAGTGG - Intergenic
1004125489 6:12868900-12868922 TTCCAAGCAGAATTCCAAAGGGG + Intronic
1007045537 6:38770151-38770173 TGACAATTAGAACTCCCAAGAGG - Intronic
1007055566 6:38880724-38880746 TGCAAATTAAAACTCCAATGGGG + Intronic
1007631930 6:43277451-43277473 TGCCAACCAGAAAGGCAAAGGGG + Intronic
1007993763 6:46284439-46284461 TGCAAACATGAACTCCAAAATGG + Intronic
1008538169 6:52523627-52523649 TGCCAAATTGCCCTCCAAAGAGG - Intronic
1008679184 6:53854186-53854208 TGCAAAGAAGAACTTCAAAGAGG - Intronic
1009386726 6:63093486-63093508 TTGCTAGTAGAACTCCAAAGAGG + Intergenic
1010416024 6:75612715-75612737 TGCCAAACTGATCTCCAAAGTGG - Intronic
1019756286 7:2772742-2772764 TGCCAACTATTTCTCCAAACTGG - Intronic
1019815875 7:3200260-3200282 TTGCAACGAGAACTCCAAGGGGG + Intergenic
1020176434 7:5885978-5886000 GGCCAATGAGAATTCCAAAGAGG - Intronic
1021108729 7:16669873-16669895 TGCCAAATGGAAATCCAAGGAGG + Intronic
1022453141 7:30534330-30534352 TGCCAACAAGGACTCCAAAATGG - Intronic
1026093952 7:67325940-67325962 AGTCCAATAGAACTCCAAAGAGG + Intergenic
1029232935 7:99086481-99086503 TGCCAACTTGTTTTCCAAAGTGG - Intronic
1030740730 7:113106346-113106368 CTCCAAATGGAACTCCAAAGTGG - Intergenic
1032342213 7:131084866-131084888 TGCTAACTACAACTCAAAATTGG + Intergenic
1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG + Intronic
1033013847 7:137651561-137651583 TGCCAAGTGGAACTCCAAGAAGG + Intronic
1035821541 8:2597891-2597913 TGCCAAGTTGATTTCCAAAGAGG - Intergenic
1036388154 8:8299620-8299642 TGCCAAATAGTTTTCCAAAGTGG - Intergenic
1037556572 8:20030668-20030690 TGCCAACTAAAACTACAGTGAGG + Intergenic
1037563443 8:20095702-20095724 TGCCAAATTGTTCTCCAAAGTGG + Intergenic
1037656120 8:20885687-20885709 TGCTAAATAGAACTCTGAAGGGG + Intergenic
1038584122 8:28774393-28774415 TTACAAATAGAACTCCAAAGAGG - Intronic
1040520079 8:48169132-48169154 AGCCACCAAGAAGTCCAAAGTGG - Intergenic
1041157327 8:55001892-55001914 TCCCAACTAGAACTCTCACGTGG - Intergenic
1042114585 8:65416550-65416572 TGCCAACCTGAAATCAAAAGGGG - Intergenic
1042794651 8:72648056-72648078 TGCAAACGAGAGCTCAAAAGGGG + Intronic
1044704096 8:94992056-94992078 TGCCAAATTGCCCTCCAAAGGGG + Intronic
1045119164 8:99016290-99016312 TGCCAAATAGTCTTCCAAAGTGG + Intronic
1046429820 8:114109899-114109921 TGCAAACTATAAGTCCAAAAAGG + Intergenic
1046492969 8:114977189-114977211 TGCCAAATTGTATTCCAAAGTGG - Intergenic
1048736912 8:137512360-137512382 TGCAAACTATAAATCCAAAAAGG - Intergenic
1049933922 9:482469-482491 TGCCAACTCAACCTCCAAAATGG + Intronic
1051172648 9:14334286-14334308 TGCCAAATGGATTTCCAAAGTGG + Intronic
1052365082 9:27603268-27603290 TACCAACTAGACCTCCAGATGGG + Intergenic
1055310882 9:74978394-74978416 TGCCACCTGGAACTCCCAACTGG + Intergenic
1057508440 9:95656612-95656634 TGCTAAGTTGAACTCCAAAGTGG + Intergenic
1058687629 9:107491651-107491673 TGGCAACTAGAACTCAAAAAGGG - Intergenic
1060305527 9:122407611-122407633 TGCCAAATAGTTTTCCAAAGGGG + Intergenic
1060488820 9:124066740-124066762 TGCCAACTTGCTTTCCAAAGTGG - Intergenic
1062227926 9:135464290-135464312 TGCCAACTAGACCTCCGGATGGG + Intergenic
1186709637 X:12179830-12179852 TGCAAACTAGAACACAACAGAGG - Intronic
1187365661 X:18663978-18664000 TGCCAAATAGTTTTCCAAAGAGG - Intronic
1189167798 X:38878602-38878624 TGCCAAACAGTTCTCCAAAGTGG + Intergenic
1189550101 X:42084143-42084165 TGCCAAATAGTTCTCCAAAATGG + Intergenic
1191035434 X:56021547-56021569 TGCCAAATAGATTTCCAAAGTGG + Intergenic
1191383422 X:60033645-60033667 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1191430529 X:60664836-60664858 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1192310261 X:70006294-70006316 TGCCAACCTGACTTCCAAAGTGG + Intronic
1192414710 X:70968629-70968651 TGCCAAGTAGGTTTCCAAAGTGG - Intergenic
1192581613 X:72287414-72287436 TGCCAAATTGACCTCTAAAGAGG + Intronic
1192607171 X:72530269-72530291 TCCCAAGTAGATTTCCAAAGTGG - Intronic
1193609157 X:83607640-83607662 TGCCAACTTGTTCTCCAAAACGG + Intergenic
1198479634 X:137029857-137029879 TACCAACTACAAGTCCAAAATGG + Intergenic
1199779333 X:151044070-151044092 TACCAACTTGAACTTAAAAGAGG + Intergenic
1199888922 X:152055185-152055207 TGCCAAACAGATTTCCAAAGGGG - Intergenic