ID: 1101502540

View in Genome Browser
Species Human (GRCh38)
Location 12:105317453-105317475
Sequence GTCCATCCCTGGGCTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101502536_1101502540 26 Left 1101502536 12:105317404-105317426 CCCAGGCACTGTAGCGCAGAGTC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1101502540 12:105317453-105317475 GTCCATCCCTGGGCTTAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1101502537_1101502540 25 Left 1101502537 12:105317405-105317427 CCAGGCACTGTAGCGCAGAGTCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1101502540 12:105317453-105317475 GTCCATCCCTGGGCTTAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101502540 Original CRISPR GTCCATCCCTGGGCTTAAAG AGG Intronic
903350471 1:22713535-22713557 GTCCATCCCTGGCTTTGAAGGGG - Intronic
903927157 1:26838851-26838873 GTCCATCTCTGGGGTTCATGGGG - Intronic
908964305 1:69739382-69739404 CTACATTCCTGGGCTTACAGGGG - Intronic
908967443 1:69782814-69782836 ATCCATGCCTGGGCTTCAGGTGG + Intronic
912389333 1:109291255-109291277 GTCCAGGCCTGGGCCTTAAGAGG - Intergenic
915596059 1:156897170-156897192 GGCCAGTCCTGGGGTTAAAGTGG + Intronic
916648856 1:166816649-166816671 GGCCCTCCCTGGCCTGAAAGTGG + Intergenic
920001333 1:202801665-202801687 GTCCTTGCATGGGATTAAAGAGG - Intronic
920703764 1:208236880-208236902 GGCCATACTTGGGCTTCAAGAGG - Intronic
922471774 1:225881649-225881671 GTCCACCCCTGCCCTTGAAGAGG + Intronic
1064959981 10:20953088-20953110 GTCCATACCAGGGCTGAATGGGG - Intronic
1065187370 10:23181398-23181420 TTCCATCCCTGAGTTTAAACTGG - Intergenic
1066508211 10:36066729-36066751 GTCCATCCCTGGCTTGAAACTGG - Intergenic
1067472644 10:46547849-46547871 GTCCATCGTTGGGCTTCAGGAGG + Intergenic
1068157717 10:53222925-53222947 GGCCATCCCTGGGCTAAAGGTGG + Intergenic
1068535561 10:58237330-58237352 TACCATCCCTGGGCCTGAAGTGG - Intronic
1073177097 10:101563300-101563322 GGCCATCCCTGGGAGTAGAGAGG - Intergenic
1075192263 10:120320457-120320479 GATCATCCCAGGGATTAAAGGGG - Intergenic
1080189208 11:29524871-29524893 CTGAATCCCTGGGTTTAAAGGGG - Intergenic
1080637727 11:34138430-34138452 GTCCGTCCGAGGGTTTAAAGTGG + Intronic
1081108914 11:39107332-39107354 GTCAACCCCTGGGCTCAAGGAGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084541387 11:69789161-69789183 CTGCATCCCTGGCCTCAAAGAGG - Intergenic
1089497815 11:118916562-118916584 GTCCTTCCCTGAGCTGCAAGGGG - Intronic
1090868985 11:130726297-130726319 GTCCTTCCCTGAGCGTAAAAGGG + Intergenic
1091345069 11:134846971-134846993 CGCCATCCCAGGGCTTAGAGGGG + Intergenic
1091590981 12:1842821-1842843 GTCCACCCCAAGGCTGAAAGAGG - Intronic
1092929179 12:13299185-13299207 CTCCATCTCTGTGCTTAAAGAGG + Intergenic
1096944711 12:55392121-55392143 GGCCATCCCTGGACTGAAGGTGG + Intergenic
1097250531 12:57630222-57630244 GTCCAGCCCTGGGCTGACAAGGG + Exonic
1097536163 12:60873055-60873077 GGCCATCCCTGGCCTGAAGGTGG + Intergenic
1100488035 12:95050391-95050413 CTCCATCTCTGGGGTTCAAGCGG + Intronic
1100672857 12:96835463-96835485 GGCCCTCCCTGGCCTGAAAGTGG + Intronic
1101502540 12:105317453-105317475 GTCCATCCCTGGGCTTAAAGAGG + Intronic
1102853555 12:116274832-116274854 ATCAATCCCTTGGTTTAAAGAGG + Intronic
1104818038 12:131659913-131659935 CTCCATCCCAGGCTTTAAAGAGG - Intergenic
1106634198 13:31509545-31509567 GTCCATCCCAGTCATTAAAGCGG - Intergenic
1110439138 13:75507975-75507997 GGCCATCCCTGGCTTGAAAGTGG + Intergenic
1111485694 13:88895861-88895883 GACCATCCCTGGTCTGAAGGTGG - Intergenic
1116474014 14:45318841-45318863 ATCCATGGCTGGGCTTCAAGGGG - Intergenic
1116947026 14:50845288-50845310 GGCCAGGCCTGGGCTTAAAAGGG - Intergenic
1118076129 14:62301186-62301208 TTCCATCCCTGGGGTGAAATAGG + Intergenic
1118365953 14:65096259-65096281 GTCCATCCCTGAGCTACTAGTGG + Intronic
1118722159 14:68602038-68602060 GCCCATCCCTGGGCAGAAATGGG + Intronic
1121211361 14:92210248-92210270 GGCCACCCCTGGAATTAAAGGGG + Intergenic
1121695365 14:95908068-95908090 GGCCCTCCCTGGCCTTAAGGTGG + Intergenic
1121824076 14:96996272-96996294 CTCCATCCCTGGGCTTTCATGGG - Intergenic
1121824675 14:97000707-97000729 GACCCTCCCTGGCCTGAAAGAGG + Intergenic
1122069983 14:99200053-99200075 CTCCATCCCTCGGCTTCAAAAGG + Intronic
1123888349 15:24749339-24749361 GGCCCTCCCTGGCCTGAAAGTGG - Intergenic
1125114066 15:36067779-36067801 GACCATCCCTGGCTTGAAAGTGG + Intergenic
1126156889 15:45574211-45574233 GACCTTCCCTGGCCTGAAAGTGG + Intergenic
1126185747 15:45829419-45829441 GGCCCTCCCTGGCCTGAAAGTGG + Intergenic
1131318420 15:91362774-91362796 GGCCATCCCTGCACTTCAAGTGG - Intergenic
1131392566 15:92061369-92061391 TTCCATCCCAGGGATCAAAGAGG + Intronic
1131999310 15:98163338-98163360 GGCCATCCCTGGCTTGAAAGTGG + Intergenic
1137334333 16:47533360-47533382 GGCCCTCCCTGGCCTGAAAGTGG + Intronic
1142896138 17:2980398-2980420 GGCCAGCCCTGGGCTGAGAGAGG - Intronic
1147691215 17:42315916-42315938 GACCATCCCTGGGCCTTAAGGGG - Intronic
1149447489 17:56724949-56724971 GTCCATCACTAGGCCCAAAGCGG + Intergenic
1151914480 17:77107314-77107336 CTCCATCCCTGTCTTTAAAGTGG - Intronic
1153278281 18:3390384-3390406 TTCCAGCCCTGGCCTTGAAGAGG - Intergenic
1155533109 18:26787650-26787672 GTTCATCCCTGGGCTTAGCTCGG + Intergenic
1157902518 18:51533403-51533425 CACCATGCCTGGCCTTAAAGGGG - Intergenic
1158542156 18:58366872-58366894 CTCCAGCCCTGGGCTCTAAGGGG + Intronic
1159161359 18:64646820-64646842 GTCCATCCCTGGCTTGAAGGTGG + Intergenic
1159266516 18:66087510-66087532 GTCCATCCTTTGGGTTAATGCGG - Intergenic
1159774284 18:72585642-72585664 GGCCATCCCTGGCTTGAAAGTGG + Intronic
1163585353 19:18160904-18160926 GTCCAGCCCTGGGGGTGAAGGGG - Exonic
1166159958 19:40945136-40945158 GTACAGCACTGGGCTTACAGCGG - Intergenic
1166168909 19:41013098-41013120 GTACAGCACTGGGCTTACAGTGG - Intronic
1166361722 19:42255291-42255313 GGCCGGCTCTGGGCTTAAAGGGG + Intergenic
925796072 2:7544024-7544046 GTCCCTCGCTGTGGTTAAAGTGG + Intergenic
926964686 2:18396883-18396905 CTCCACCCCTGTGCTTAAACCGG + Intergenic
929049076 2:37819261-37819283 GCCCAGCCCTGGCCATAAAGAGG + Intergenic
929726717 2:44437354-44437376 TTCAATCCCTTTGCTTAAAGAGG + Intronic
933810874 2:86032028-86032050 GGCCATCCCTGGACTTAAATCGG - Intronic
937839011 2:126506933-126506955 GTTCATCCATGTGCTCAAAGAGG + Intergenic
942908149 2:181208173-181208195 TTCAAGCCCTGGGCTGAAAGAGG + Intergenic
946075628 2:217071320-217071342 GTCCATGCCTGGGCTGATGGGGG - Intergenic
947083986 2:226430219-226430241 TTCCATTCCTGGGCTTAAGATGG + Intergenic
947327277 2:228992500-228992522 GTTCCTCCCTGGCCTGAAAGTGG + Intronic
947899965 2:233713055-233713077 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
947900666 2:233718884-233718906 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
947902050 2:233729190-233729212 GTCCAGCCCTGGGCTGAGAGTGG + Exonic
947904111 2:233747277-233747299 GCCCAGCCCTGGGCTGAGAGTGG + Intronic
1168963904 20:1887365-1887387 GTCCATCCCTGGGCAGGAACTGG - Intergenic
1175155926 20:56971550-56971572 GTGTTTCCCTGGGCTTAAAAGGG + Intergenic
1184173858 22:42774951-42774973 GGCCCTCCCTGGTCTGAAAGTGG - Intergenic
1184865837 22:47201565-47201587 GGCCTTCCCTGGCCTGAAAGTGG + Intergenic
949727865 3:7071384-7071406 CTCCATCCCTGCTTTTAAAGAGG + Intronic
950357713 3:12425696-12425718 GTACATCACTAGGCTTAAGGGGG + Intronic
950634669 3:14306497-14306519 CTCCTTCCCTTGGCTTAAATGGG + Intergenic
954779922 3:53051404-53051426 GTCCATCTGTGGGATTACAGGGG - Intronic
956198221 3:66675167-66675189 GTGCATCCTTGGGCTGAAATAGG + Intergenic
956770319 3:72520428-72520450 GTCCATCCCTTGGCCTACAATGG + Intergenic
958403176 3:93715187-93715209 TTCCATCCAAGGCCTTAAAGAGG + Intergenic
959476796 3:106821748-106821770 GGCCATCCCTGGCTTGAAAGTGG - Intergenic
959646348 3:108707478-108707500 GGCTATCTCTAGGCTTAAAGAGG + Intergenic
967086258 3:186097731-186097753 CTCCAAGCCTGGGCTTAATGGGG - Intronic
969179221 4:5424341-5424363 GACCATCCCTGGCTTGAAAGTGG - Intronic
974084837 4:57248634-57248656 GAAGATCCCTGGGCTTATAGGGG + Intergenic
974908284 4:68083326-68083348 GTCCATCCCTGTGCCTTAGGGGG - Intronic
976280328 4:83320733-83320755 ATCCATCCCTGGGCTCACAGAGG + Intronic
977350788 4:95884324-95884346 GTCCATCTCTGTGTTTACAGTGG + Intergenic
978149374 4:105415189-105415211 GGCCATCCCTGGCTTTAAGGTGG + Intronic
979490440 4:121320536-121320558 TTCCACCCCTGGGCCTGAAGGGG - Intergenic
979720059 4:123888850-123888872 TTACATCCCTGGGCTTAACATGG - Intergenic
982817586 4:159905557-159905579 GTCCAAGTTTGGGCTTAAAGGGG + Intergenic
985636600 5:1038729-1038751 GTTCCTCCCGGGGCTTCAAGGGG + Exonic
986085037 5:4436667-4436689 GATCCTCCCTGGGCTTGAAGAGG - Intergenic
989339158 5:40354630-40354652 GGCCATCCCTGGCCTAAAAGTGG - Intergenic
992877242 5:81068958-81068980 ATGCATCCCTGGGCAGAAAGAGG - Intronic
994200079 5:96963598-96963620 GTCCAATCCTAGGCTTTAAGAGG - Intronic
995313093 5:110735617-110735639 GTCCAACCCTGCACTTAAAGGGG - Intronic
997968434 5:138379736-138379758 GTCCATCCATCCCCTTAAAGAGG + Intronic
998480550 5:142459318-142459340 GGCCATCCCTGGCCTGAAGGTGG + Intergenic
1002693403 5:181066637-181066659 GGCCCTCCCTGGCCTGAAAGTGG + Intergenic
1006347951 6:33498217-33498239 GGCCCTCCCTGGCCTGAAAGTGG - Intergenic
1013904448 6:115198647-115198669 GTCCAGGCCATGGCTTAAAGGGG - Intergenic
1014770470 6:125453398-125453420 GGCCATCCCTGGCCTGAAGGTGG - Intergenic
1017834769 6:158167762-158167784 TTCCATCTCTGGGGTTAGAGAGG + Intronic
1024024607 7:45400005-45400027 GGCCATCCCTGGCCTGAAGGTGG - Intergenic
1026123989 7:67563359-67563381 GTCCAAGCCTAGGCTTTAAGAGG - Intergenic
1027188782 7:75986322-75986344 GTGCATCCCTGGGCAGGAAGAGG - Exonic
1040739442 8:50555103-50555125 GTCCCTCCTTAGGCTTACAGAGG - Intronic
1041727205 8:61029493-61029515 TACCATCCCTGGGCAGAAAGGGG - Intergenic
1043082552 8:75784611-75784633 GGCCATCCCTGGCCTGAAGGTGG + Intergenic
1043655335 8:82657918-82657940 GTCCATCCTTAGGCTCAAAATGG - Intergenic
1045319155 8:101068575-101068597 GTTCATCTTTGGGCCTAAAGGGG - Intergenic
1045664228 8:104468264-104468286 GACCATCCCTTTGCTTATAGGGG + Intergenic
1047294456 8:123558902-123558924 CGCCATCCCTAGGCCTAAAGCGG + Intergenic
1048547970 8:135404785-135404807 GGCCATCCCTGGCTTGAAAGTGG + Intergenic
1049787424 8:144457650-144457672 CTTCTTCCCTGGGGTTAAAGGGG + Intronic
1053128166 9:35599482-35599504 GGCCCTCCCTGGCCTGAAAGTGG - Intergenic
1055788775 9:79899235-79899257 GTCCATTCCTGTGCCTAAGGTGG - Intergenic
1059041671 9:110822053-110822075 CTCCTTCCCTGTGCTTAAGGAGG + Intergenic
1059769142 9:117411649-117411671 AACCATCCCTGGTATTAAAGGGG - Intronic
1185446564 X:261040-261062 GCCCATCCCTGGGCTTCATGAGG - Intergenic
1190998825 X:55637668-55637690 GCCCATCCCTGGCCTGAAGGTGG - Intergenic
1192197362 X:69037559-69037581 ATCCAAGCCTGGGCTTTAAGAGG + Intergenic
1194230452 X:91316278-91316300 TTCCATCCCTAGGAGTAAAGAGG - Intergenic
1198189479 X:134288052-134288074 GGCCATCCCTGGCCTGAAGGTGG - Intergenic
1198576579 X:138016749-138016771 GTCTATGCATGGGCTTCAAGGGG + Intergenic
1200749159 Y:6929152-6929174 GGCCATCCCTGGCCTGAAGGTGG + Intronic