ID: 1101502664

View in Genome Browser
Species Human (GRCh38)
Location 12:105318832-105318854
Sequence CGGGCATGAGCCACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328899
Summary {0: 84, 1: 8789, 2: 40984, 3: 102915, 4: 176127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101502664_1101502674 11 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502674 12:105318866-105318888 CTTTAGGAGGCTGAGGTGGGAGG 0: 800
1: 26400
2: 83667
3: 177852
4: 195160
1101502664_1101502672 7 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502672 12:105318862-105318884 GGCACTTTAGGAGGCTGAGGTGG 0: 37
1: 2785
2: 68571
3: 156302
4: 160977
1101502664_1101502666 -5 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502666 12:105318850-105318872 GCCCGCAATCCTGGCACTTTAGG 0: 1
1: 29
2: 1652
3: 26541
4: 259529
1101502664_1101502671 4 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502671 12:105318859-105318881 CCTGGCACTTTAGGAGGCTGAGG 0: 13
1: 847
2: 12626
3: 113151
4: 233494
1101502664_1101502676 27 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502676 12:105318882-105318904 TGGGAGGATCACTTGAGGCCAGG 0: 1920
1: 16397
2: 53809
3: 123827
4: 185367
1101502664_1101502669 -2 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502669 12:105318853-105318875 CGCAATCCTGGCACTTTAGGAGG 0: 1
1: 0
2: 146
3: 3844
4: 48578
1101502664_1101502675 22 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502675 12:105318877-105318899 TGAGGTGGGAGGATCACTTGAGG 0: 1261
1: 7600
2: 29390
3: 64617
4: 98309
1101502664_1101502673 8 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502673 12:105318863-105318885 GCACTTTAGGAGGCTGAGGTGGG 0: 980
1: 35772
2: 141514
3: 240842
4: 258836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101502664 Original CRISPR CGGGCATGAGCCACCATGCC TGG (reversed) Intronic