ID: 1101502666

View in Genome Browser
Species Human (GRCh38)
Location 12:105318850-105318872
Sequence GCCCGCAATCCTGGCACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287752
Summary {0: 1, 1: 29, 2: 1652, 3: 26541, 4: 259529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101502664_1101502666 -5 Left 1101502664 12:105318832-105318854 CCAGGCATGGTGGCTCATGCCCG 0: 84
1: 8789
2: 40984
3: 102915
4: 176127
Right 1101502666 12:105318850-105318872 GCCCGCAATCCTGGCACTTTAGG 0: 1
1: 29
2: 1652
3: 26541
4: 259529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101502666 Original CRISPR GCCCGCAATCCTGGCACTTT AGG Intronic
Too many off-targets to display for this crispr