ID: 1101503121 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:105322298-105322320 |
Sequence | AGGGCATGTGCTTCTCATAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 170 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 17, 4: 151} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101503121_1101503129 | 25 | Left | 1101503121 | 12:105322298-105322320 | CCACTATGAGAAGCACATGCCCT | 0: 1 1: 0 2: 1 3: 17 4: 151 |
||
Right | 1101503129 | 12:105322346-105322368 | AGGACAAACAACTCAGAGTTAGG | 0: 1 1: 0 2: 1 3: 10 4: 198 |
||||
1101503121_1101503124 | 5 | Left | 1101503121 | 12:105322298-105322320 | CCACTATGAGAAGCACATGCCCT | 0: 1 1: 0 2: 1 3: 17 4: 151 |
||
Right | 1101503124 | 12:105322326-105322348 | GCCACTGCCTCTTCAGTCCCAGG | 0: 1 1: 0 2: 2 3: 39 4: 598 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101503121 | Original CRISPR | AGGGCATGTGCTTCTCATAG TGG (reversed) | Intronic | ||