ID: 1101503121

View in Genome Browser
Species Human (GRCh38)
Location 12:105322298-105322320
Sequence AGGGCATGTGCTTCTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101503121_1101503129 25 Left 1101503121 12:105322298-105322320 CCACTATGAGAAGCACATGCCCT 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1101503129 12:105322346-105322368 AGGACAAACAACTCAGAGTTAGG 0: 1
1: 0
2: 1
3: 10
4: 198
1101503121_1101503124 5 Left 1101503121 12:105322298-105322320 CCACTATGAGAAGCACATGCCCT 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1101503124 12:105322326-105322348 GCCACTGCCTCTTCAGTCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101503121 Original CRISPR AGGGCATGTGCTTCTCATAG TGG (reversed) Intronic