ID: 1101506231

View in Genome Browser
Species Human (GRCh38)
Location 12:105349293-105349315
Sequence TCTCCCACCCAAAACTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101506228_1101506231 -2 Left 1101506228 12:105349272-105349294 CCAGTGAAGGGTGGGATCAACTC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1101506231 12:105349293-105349315 TCTCCCACCCAAAACTGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 122
1101506227_1101506231 -1 Left 1101506227 12:105349271-105349293 CCCAGTGAAGGGTGGGATCAACT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1101506231 12:105349293-105349315 TCTCCCACCCAAAACTGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101506231 Original CRISPR TCTCCCACCCAAAACTGGGT TGG Intronic
901064635 1:6489000-6489022 TCTCCCACCCAGACCAGGCTGGG - Intronic
902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG + Intronic
905657038 1:39691853-39691875 TATCCCACCCGAAATTGGGAGGG + Intergenic
905812098 1:40920144-40920166 TGACCAACCCAATACTGGGTTGG + Intergenic
909698453 1:78492688-78492710 TCTCCCTCTCAAAACTGTGCAGG - Exonic
910179990 1:84472233-84472255 CCTCCCACCCAAAGCTGAATTGG - Intergenic
912415366 1:109504801-109504823 TCTCATTCCCTAAACTGGGTAGG + Exonic
912805641 1:112754961-112754983 TTCCCCACCCAAAATTGGTTTGG + Intergenic
916419770 1:164626065-164626087 CTCCCCACCCAAAACTGGGGTGG - Intronic
917028974 1:170669067-170669089 TCCTTCACCCAAAAGTGGGTAGG - Intronic
922696437 1:227733321-227733343 TCTCCCAGCCAGAGCTGGGCTGG - Intronic
1064377754 10:14812295-14812317 TCTGCCACCCAGAAAGGGGTGGG - Intergenic
1065886716 10:30084471-30084493 TCACCCTCCCTAAAGTGGGTAGG + Intronic
1067274873 10:44825053-44825075 TCTCCCTCCAAAAACTGGATGGG + Intergenic
1067659593 10:48224381-48224403 TCTGCCTTCCAAAACTGGGCAGG - Intronic
1072680145 10:97499883-97499905 TCTCACTCCCAAAGCTGGGAAGG - Intronic
1072953618 10:99870081-99870103 TTTCAAACACAAAACTGGGTGGG - Intergenic
1073221989 10:101882502-101882524 TTTCCCACCCAACACTGAGATGG + Intronic
1076071748 10:127495991-127496013 TCTCCCACCCAAGACTGACAGGG - Intergenic
1076988593 11:257255-257277 TCACCCACCCAAGGCTGGGCTGG - Intergenic
1077299893 11:1841982-1842004 ACTCCCACCCAGACCTGGCTCGG - Intergenic
1084147460 11:67272688-67272710 GCTCCTTCCCAAAGCTGGGTGGG + Intronic
1087021790 11:93610515-93610537 TCTCCCACCAAAAACAGAGTAGG + Intergenic
1089306248 11:117528162-117528184 TCTCCCACCCCCAACCCGGTGGG + Intronic
1089698307 11:120229129-120229151 GCTCCCACCCTAGCCTGGGTAGG - Exonic
1090435783 11:126685307-126685329 CCTCACACCCAGCACTGGGTGGG + Intronic
1091678933 12:2512393-2512415 ACTACCACTCAATACTGGGTGGG + Intronic
1092746682 12:11678943-11678965 TCTCCCTCCCCAATGTGGGTGGG - Intronic
1095300076 12:40574174-40574196 TCTCATACACAAAACTGGGTAGG + Intergenic
1096789899 12:54038124-54038146 TCTCCCACCCCAGCCTGGGAAGG - Intronic
1099810447 12:87575675-87575697 TCTCCCTCCCAAAATTGCTTTGG - Intergenic
1101506231 12:105349293-105349315 TCTCCCACCCAAAACTGGGTTGG + Intronic
1102831040 12:116000107-116000129 TCTCCCTCCCAAACCTGGATTGG + Intronic
1104616781 12:130277047-130277069 TCTCCCACCCAAAACACTGGAGG + Intergenic
1107362243 13:39632276-39632298 TCTCGCATCCAAAAGTGGGGGGG + Intergenic
1110201315 13:72852806-72852828 TCTCTCATGAAAAACTGGGTTGG - Intronic
1114562181 14:23601323-23601345 TCTCCCACCAAGGACAGGGTTGG - Intergenic
1115924722 14:38418737-38418759 TTTCCCACCCAAACCAAGGTAGG + Intergenic
1118882867 14:69843520-69843542 TCTCCCACTCAGATCTGGCTGGG - Intergenic
1119676990 14:76563191-76563213 TCTCCCACCCAGAACTCTGTTGG + Intergenic
1120883335 14:89432244-89432266 TCTCCCACCCATAAATGGAGAGG - Intronic
1123011361 14:105351036-105351058 GCTCCCACCCGAACCTGGGCTGG + Intronic
1124022676 15:25938793-25938815 TCCCCCCTCCAAAACTTGGTGGG - Intergenic
1124038137 15:26075662-26075684 TCTCCAACCAGAAACTGGGCTGG + Intergenic
1125175347 15:36815430-36815452 TCTCCCACTCAAACCAGGCTAGG + Intergenic
1128881939 15:71252002-71252024 ACTCCCACCCAAAAGAGGGAGGG - Intronic
1128998773 15:72316341-72316363 CCTCCCATCCGAAACTGAGTTGG - Intronic
1134846668 16:17446594-17446616 TCTCACTCCCAAGACTGGGAGGG - Intronic
1135060912 16:19270678-19270700 TCACCAACCCATAACAGGGTAGG - Intergenic
1137534919 16:49312954-49312976 TCCCCCAGCCATAAATGGGTTGG + Intergenic
1137598229 16:49738793-49738815 TCTCCCATCCAAATCTGATTGGG - Intronic
1140555878 16:75920708-75920730 TCTACTACCAAAAACTGGCTGGG - Intergenic
1143515013 17:7415141-7415163 TCTCCCACCCCATACCGGGCAGG - Exonic
1144848670 17:18233178-18233200 TCTCCCACCCACAACTGAAGAGG - Intronic
1149250310 17:54760665-54760687 GCTCCCACCAAGAACAGGGTGGG - Intergenic
1149406390 17:56356141-56356163 TATCCCACCCACTCCTGGGTGGG - Intronic
1149649989 17:58270850-58270872 TCTCCCACCAAAACCTGCATGGG + Exonic
1155167089 18:23240249-23240271 TCTCCCTACCAAAACCTGGTGGG - Intronic
1155999271 18:32366771-32366793 TCTACATACCAAAACTGGGTTGG + Intronic
1156444431 18:37224714-37224736 TCTCCCACCCTTGACTGGTTGGG + Exonic
1160874742 19:1291710-1291732 AATCTCACCCAAAACTGGGGTGG - Intronic
1161207561 19:3049294-3049316 TCACCCACCAAAAGCAGGGTGGG - Intergenic
1162156810 19:8684088-8684110 TCTCCCACGCAAAAAGGGGCGGG - Intergenic
1162746270 19:12800428-12800450 TCACCCACCCCACCCTGGGTTGG + Intronic
1163802506 19:19375099-19375121 TTTCCCATCTAACACTGGGTTGG + Intergenic
1166457002 19:42949989-42950011 TGTCCCAGGCAAACCTGGGTAGG - Intronic
1166493862 19:43283920-43283942 TGTCCCAGGCAAACCTGGGTAGG - Intergenic
1167088131 19:47324412-47324434 TCTCCTTCCCAAATCAGGGTGGG - Intergenic
1167836959 19:52080874-52080896 GCAACCACCCAAAACTGGGGAGG + Intronic
1168250070 19:55137020-55137042 GCTCACACCCAGATCTGGGTGGG - Intronic
1168366308 19:55790917-55790939 TCACCTACCCAAAGCTGGATAGG - Intronic
928264611 2:29800967-29800989 TCTCTCACCCAAATCGGGGTAGG + Intronic
929407375 2:41658307-41658329 TCTCTCACACAAAGCTGGATTGG + Intergenic
937807251 2:126160832-126160854 TTTCAAACACAAAACTGGGTGGG + Intergenic
944107709 2:196097271-196097293 TCTCCTCCCCAAAAGTGGGGCGG - Intergenic
948328235 2:237143558-237143580 TCCCCCACTCAAATCTGGGCAGG - Intergenic
1168872859 20:1145836-1145858 TCTGCCAACCAAAACCAGGTTGG - Intronic
1169542570 20:6616399-6616421 AAACCCACCCAAAACTTGGTGGG + Intergenic
1171145189 20:22775073-22775095 GCTCCCACCCCAAGCTGGGCTGG - Intergenic
1172056743 20:32159458-32159480 TCTCCCAGGCAAACCTGTGTGGG - Intronic
1175319710 20:58076599-58076621 CCTCCCTCCCACAGCTGGGTGGG + Intergenic
1175500144 20:59444294-59444316 TCGCCCACCCCCAACTAGGTTGG - Intergenic
1178107981 21:29342214-29342236 TCTCCCACCCAAAACTCTTGGGG - Intronic
1179591772 21:42413727-42413749 TCTCCCACTCAAGGCTGGGGTGG - Intronic
1180612060 22:17104547-17104569 TCTCCCACCCTCACCTGGGCAGG + Intronic
1182551456 22:31103045-31103067 TCTAGCACCCACAACTGGTTAGG + Intronic
1184659583 22:45959771-45959793 ACTTCCACCCTGAACTGGGTGGG - Intronic
1185035328 22:48473232-48473254 TCTCCCACTCAAATTTGGCTTGG - Intergenic
952402351 3:32974822-32974844 TCACCCACCCTAATGTGGGTGGG - Intergenic
953488748 3:43328735-43328757 TCTCCCATCTCAAACTGTGTTGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956464658 3:69506957-69506979 TGTCCCACCAAAAATTGGGTGGG + Intronic
956679421 3:71764500-71764522 TCACCCATCCAAAACCGGTTTGG - Intergenic
959799734 3:110478047-110478069 TCCCCCACCCAAAAGTCAGTGGG + Intergenic
960851632 3:122060686-122060708 TTTCCCACCCAAAACTAGTTTGG + Intronic
964586302 3:158307511-158307533 TCCCACACCCAAAAGTGGTTTGG - Intronic
967219743 3:187238495-187238517 TCTCCCAGGAAAGACTGGGTGGG - Intronic
969100779 4:4766551-4766573 TCTCCAACCCAACCCTGAGTGGG - Intergenic
969448631 4:7260055-7260077 TCTCCAACCCAAGCCTGGGAGGG - Intronic
973058148 4:45686379-45686401 TTTCCCACACAAAACTTGTTTGG - Intergenic
984710300 4:182879115-182879137 CCTCACACCCCAAACTGGGAAGG - Intergenic
991034907 5:62119426-62119448 TTTCCCTCCCCAAAGTGGGTGGG - Intergenic
993353707 5:86880828-86880850 TCTCTCACCCAAAACAGGAGTGG - Intergenic
994362296 5:98866084-98866106 ACTCCCACCCAATACAGAGTAGG + Intronic
997236339 5:132274360-132274382 TCTCCCACCTATGACTGGGTGGG - Intronic
1000300570 5:159952644-159952666 TCTCCCACCTAGAATTGTGTTGG + Intronic
1004312339 6:14556508-14556530 TCCCACCCCCAAAACTGGGTAGG - Intergenic
1005700898 6:28399498-28399520 TCTCCCTCCCCAAAGTGCGTTGG - Intronic
1012998261 6:105994505-105994527 TCGCTCACCAAAAACGGGGTGGG + Intergenic
1013385339 6:109624191-109624213 TCTCCTACCCCAAACTGGATTGG + Intronic
1015893217 6:137989851-137989873 TTTCGTGCCCAAAACTGGGTAGG + Intergenic
1017882977 6:158574270-158574292 TTTCTTACCCAAAACTGGGTTGG + Intronic
1019389224 7:776460-776482 TCTCCAAACCAGCACTGGGTGGG + Intronic
1020762857 7:12289828-12289850 TTTCACACCCACAACTTGGTAGG - Intergenic
1022277995 7:28875336-28875358 TCAACCACCCAAAACTCAGTAGG + Intergenic
1022372434 7:29784090-29784112 TCTCCTACTCTAAACTGGGCTGG - Intergenic
1024761220 7:52598243-52598265 ACCTCCAGCCAAAACTGGGTGGG + Intergenic
1037974540 8:23200272-23200294 TCTCCCAGCCAAGTCTGGGAAGG - Intronic
1040111625 8:43569342-43569364 TCCCCCAGCCCAAACTGGGGGGG - Intergenic
1040631796 8:49222350-49222372 TCCACCACCCAAAACTCTGTAGG - Intergenic
1043988176 8:86718683-86718705 TCTACCACCCAAACCAGGGAAGG + Intronic
1046127663 8:109930147-109930169 TCTCCCTGCCAAAACTAGGTTGG - Intergenic
1047701227 8:127451389-127451411 TCTCTCACCCACAAGTGTGTAGG - Intergenic
1049554179 8:143274046-143274068 CCTCCCACCCAAGACTTGGTGGG - Intronic
1050339314 9:4620124-4620146 TCTCCCACCCCCAGCTGGGCAGG + Intronic
1052753506 9:32516479-32516501 ACTTCCAGCCAAAATTGGGTGGG - Intronic
1053222730 9:36325540-36325562 TCTACCACCCAAACCTGACTTGG - Intergenic
1053431111 9:38042468-38042490 TCTCCAACCCTAAAATGGGAAGG + Intronic
1054971358 9:71091384-71091406 TCTCCAACCCTGAACTGGGATGG - Intronic
1055489428 9:76789666-76789688 TCTCCCAGCCATAAGTGTGTGGG - Intronic
1056383792 9:86078998-86079020 TCTCCCACCCAAAGCTGCTTGGG + Intronic
1057075037 9:92134204-92134226 CCTCCCACCCAGACCTGGGATGG + Intergenic
1059321979 9:113477041-113477063 TCTCCCACCCCACACTAGATTGG + Intronic
1059476491 9:114551793-114551815 TCTCCATCCCAAAAGTGGGAAGG + Intergenic
1062205864 9:135336761-135336783 TCTCCCAGCCAAGACTTGGTGGG + Intergenic
1190618767 X:52264725-52264747 TCTCCCTCCCACATCTGGGCAGG - Intergenic
1191740947 X:64434708-64434730 TCTCCCAACCCAAACTGGAGAGG - Intergenic
1200044457 X:153393648-153393670 GCTCCCACCCACAACTGAGTGGG + Intergenic
1200252692 X:154562123-154562145 GCTCCCAGCCAACACTGGGGTGG - Intronic
1200265075 X:154642293-154642315 GCTCCCAGCCAACACTGGGGTGG + Intergenic