ID: 1101510336

View in Genome Browser
Species Human (GRCh38)
Location 12:105387348-105387370
Sequence AATCCCAAGCTGTTGCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101510336_1101510339 17 Left 1101510336 12:105387348-105387370 CCTCTAGGCAACAGCTTGGGATT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1101510339 12:105387388-105387410 TACTGCTAGAGAATTTAATTTGG 0: 1
1: 0
2: 0
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101510336 Original CRISPR AATCCCAAGCTGTTGCCTAG AGG (reversed) Intronic
904420679 1:30389283-30389305 AATTCCAAGCTGTCTCCTGGTGG - Intergenic
905290078 1:36915506-36915528 TAACCAAAGCTGCTGCCTAGGGG + Intronic
905547566 1:38811712-38811734 TATCCCAAGCTCTTGCCCAGAGG - Intergenic
908388142 1:63662163-63662185 ACTTCCAAGCTGTTGCCAAGTGG - Intergenic
909649611 1:77959571-77959593 GATCCCATTCTGTTGCCCAGGGG + Intronic
909709288 1:78626965-78626987 AATCCCAAACTGTAGCCTAAGGG + Intronic
911745988 1:101442425-101442447 AATCCCACCCTGTACCCTAGGGG - Intergenic
915490850 1:156249356-156249378 CTTCCCAAGCTGTGGCTTAGAGG - Exonic
918092550 1:181310044-181310066 AAGCCCATGCTGTATCCTAGAGG - Intergenic
920282796 1:204857097-204857119 AATGCTAAGCTGTTTTCTAGAGG + Intronic
923804256 1:237241345-237241367 AATGCCAAACTGTTGCCCATTGG - Intronic
924404457 1:243728213-243728235 AATCCCTTGCTGTTGCATAATGG + Intronic
1067290889 10:44939182-44939204 AATGCCAAACTGTTTTCTAGAGG + Intergenic
1069985499 10:72280238-72280260 AGTCTCAATCTGTTGCCCAGTGG - Intergenic
1071129010 10:82370163-82370185 TATCCCAAGCTCTTGCCCAGTGG + Intronic
1072905460 10:99449233-99449255 ATCCCCAAACTGTTGCCCAGGGG - Intergenic
1075928238 10:126270859-126270881 AATTCTAAGCTGGAGCCTAGTGG - Intronic
1083546342 11:63551806-63551828 AATCCAGAGCTTTTGCTTAGTGG - Intergenic
1084743962 11:71155797-71155819 AATGCCATGCTGGTGCCTGGGGG - Intronic
1086349824 11:85934589-85934611 AATCTCAAGCTGTTACCTTAAGG + Intergenic
1088520088 11:110688238-110688260 AATTCCAAAGTGTTCCCTAGAGG + Intronic
1090154962 11:124427612-124427634 AATCCCAAGTCCCTGCCTAGAGG - Intergenic
1101497769 12:105272020-105272042 GATCTCAATCTGTTGCCTGGGGG + Intronic
1101510336 12:105387348-105387370 AATCCCAAGCTGTTGCCTAGAGG - Intronic
1101837450 12:108305317-108305339 AATCCCGAGCTGATGCTTAAAGG - Intronic
1104229227 12:126867764-126867786 AATCTGCAGCTGTTTCCTAGGGG - Intergenic
1107255997 13:38427443-38427465 CATCCCAAAGTTTTGCCTAGTGG - Intergenic
1113651052 13:112034506-112034528 AATCCCAGGCTCTTACCTAGGGG + Intergenic
1114837081 14:26215605-26215627 AATGCCTATCTGTTACCTAGGGG + Intergenic
1122634947 14:103125429-103125451 AAGCCCAAGCTATTGACTATAGG + Intronic
1123585822 15:21759993-21760015 CATTCTAATCTGTTGCCTAGGGG + Intergenic
1123622464 15:22202581-22202603 CATTCTAATCTGTTGCCTAGGGG + Intergenic
1130093541 15:80840125-80840147 AGTCCCAAGGTGCTTCCTAGGGG + Intronic
1131948303 15:97652142-97652164 AATCCACACCTCTTGCCTAGAGG + Intergenic
1135718592 16:24794908-24794930 AATCCCAAGCTGTAGCAGTGGGG - Intronic
1141241661 16:82270705-82270727 CATCCCATGCAGTTGTCTAGAGG - Intergenic
1148119200 17:45197760-45197782 TATCCCAAGGAGTTGCCTTGGGG + Intergenic
1149058428 17:52391961-52391983 ATTCCCAATATTTTGCCTAGTGG - Intergenic
1151188298 17:72379656-72379678 AATCCCGTGCTGGTGCCTGGAGG - Intergenic
1161512986 19:4682170-4682192 AATCCCATGCAGTCACCTAGGGG - Intronic
1162355451 19:10180919-10180941 ATTCCCAAGCTATTCACTAGTGG + Intronic
928257614 2:29737799-29737821 CATCCCAAAATGTTTCCTAGTGG - Intronic
935112570 2:100105779-100105801 AATCCGGAGCTGTGGCCAAGAGG - Intronic
935676429 2:105598324-105598346 AATGGGAAGCTGCTGCCTAGGGG + Intergenic
938608202 2:132918839-132918861 AATCACAATCTGATGCCTAAAGG + Intronic
938780746 2:134582612-134582634 AAGCCCAAGCTGGTGCATGGTGG + Intronic
940654189 2:156468579-156468601 AACCCCAAGATGTAACCTAGAGG - Intronic
943878463 2:193105508-193105530 AGTACTAAGCTGTTGCCTAAAGG + Intergenic
1172055403 20:32151030-32151052 AATCCCAGGCTGTTACCCACAGG + Intronic
1173503497 20:43569851-43569873 AATCCCACCCTGTGGCCTATGGG - Intronic
1178927527 21:36788101-36788123 AAAACCAAGATGTTTCCTAGAGG + Intronic
1181092266 22:20481985-20482007 ACTCCCATGCTGTTGAGTAGTGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950176153 3:10876261-10876283 AATGCCATGCAGGTGCCTAGTGG - Intronic
952314958 3:32224562-32224584 AAGTCCAGGCTGATGCCTAGGGG + Intergenic
963402079 3:144811186-144811208 AATCCCAAGATGTTGCTGGGTGG + Intergenic
965496435 3:169404549-169404571 GATCCCACACTGTTGCCTATGGG + Intronic
971223650 4:24732234-24732256 CATCCCAAAGTGTTGCCAAGTGG + Intergenic
971333979 4:25705656-25705678 AATCCCAATATCTTGCCCAGTGG - Intergenic
975930220 4:79512566-79512588 AAGCCCAGGCTGTTTCCCAGTGG + Intergenic
980094275 4:128473448-128473470 TATCCAAAGCTGCTGCCTACTGG + Intergenic
980860157 4:138489802-138489824 AAATTCAAGCTGTTGCATAGTGG - Intergenic
981047576 4:140279451-140279473 AATTCCAAGCAGTTGACTAGTGG - Intronic
993057161 5:82994783-82994805 AATCCCAAGATTTTGTCTTGAGG - Intergenic
995716197 5:115083791-115083813 AATCACAGGCTGATGACTAGAGG - Intergenic
997600003 5:135132583-135132605 AATCCCAGGCTGCTGCTTTGTGG + Intronic
997803864 5:136893502-136893524 AATTCTAAGCTGTAGCCTATGGG - Intergenic
998298087 5:140990921-140990943 AATCCCATACTGTTGCCTCCTGG + Intronic
999245958 5:150154914-150154936 AATCCCCAGAGGTTGCCTGGCGG + Intronic
1001162413 5:169332298-169332320 AATCCCCAACTGGTGCTTAGGGG - Intergenic
1003714514 6:8631623-8631645 AATCCCCTGCTCTTGCCTAATGG - Intergenic
1004483464 6:16042992-16043014 AATCCCAAGCTCCTCCCTAGAGG - Intergenic
1004820931 6:19367123-19367145 AATCCTAATTTATTGCCTAGTGG + Intergenic
1007136802 6:39530215-39530237 AAGCCAAAGCTGTAGCCTGGAGG - Intronic
1010117489 6:72331678-72331700 AATCCCAAACTGTTTCCTGTGGG - Intronic
1012490943 6:99781786-99781808 AAACCCCAGCTGTTTCCTATAGG - Intergenic
1017584689 6:155907877-155907899 AAGCCCAAGGTTTTGCCTAGTGG + Intergenic
1020683829 7:11269203-11269225 AATTCCAAGATTTTGCTTAGAGG + Intergenic
1024999925 7:55307286-55307308 AATCCCAAGGCCTTGCCCAGAGG - Intergenic
1025075665 7:55940762-55940784 AATTACAAGTTGTTGCCTATAGG - Exonic
1035031580 7:155864450-155864472 AAGGACAAGCTGTTGCCTCGGGG - Intergenic
1039830732 8:41211802-41211824 AATCCCAACCTGGTGACTACAGG - Intergenic
1039875855 8:41585082-41585104 AATAGGAAGCTGTTGCTTAGTGG - Intronic
1041617986 8:59930775-59930797 AATTCCAAGGTTGTGCCTAGCGG + Intergenic
1048375438 8:133818784-133818806 AATTGCCACCTGTTGCCTAGAGG + Intergenic
1049751887 8:144288823-144288845 AAACCCAACCTGTTGCCAGGAGG + Intronic
1057067074 9:92064847-92064869 AACCCCAAAGTGTTGCCTACTGG + Intronic
1188910264 X:35839088-35839110 CACCCCATGCTGTGGCCTAGTGG - Intergenic
1194524653 X:94965111-94965133 AATGACAAGCTGTTGTCTAAAGG + Intergenic
1194785172 X:98074685-98074707 CATACCAAGCTTTAGCCTAGTGG + Intergenic
1195077628 X:101342617-101342639 AAGCCCAAATTGTTGCCTTGGGG + Intergenic
1197058269 X:122146670-122146692 ATTCCAAAACTGTTGCATAGCGG - Intergenic