ID: 1101511464

View in Genome Browser
Species Human (GRCh38)
Location 12:105396749-105396771
Sequence CTAATAAGAGGCAGAATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101511456_1101511464 30 Left 1101511456 12:105396696-105396718 CCACTATGGGTATGGGGTGAGAA 0: 1
1: 0
2: 1
3: 4
4: 91
Right 1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG 0: 1
1: 0
2: 0
3: 19
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101511464 Original CRISPR CTAATAAGAGGCAGAATTTT TGG Intergenic
903097065 1:20986962-20986984 CTCATTTGAGGCAGTATTTTGGG + Intronic
906008096 1:42495778-42495800 CTAATAAGAGGAATTATTTAAGG + Intronic
907868283 1:58419859-58419881 CTAATAGGAGCTAGAATCTTAGG - Intronic
909125386 1:71661777-71661799 CTACTAAGAGGTAGAATAATGGG - Intronic
909742654 1:79050133-79050155 CTAATAGAAGACTGAATTTTGGG - Intergenic
910505554 1:87946386-87946408 CTAAGAGGAGGAAGAAATTTGGG + Intergenic
910761136 1:90732478-90732500 CTAAGAAGAGGCCAAATTATGGG - Intergenic
911830906 1:102550492-102550514 CTAAAATGAGGCAAAACTTTGGG - Intergenic
911853636 1:102851040-102851062 CCAATTAGGGGCAGAAGTTTAGG - Intergenic
912341542 1:108920698-108920720 CTAATAAAAGGAAAAATTATGGG + Intronic
916597123 1:166254589-166254611 ATAATTAGAGACAGAATTTAAGG - Intergenic
917356966 1:174135799-174135821 GTAATATGAGGCAGAATAATGGG - Intergenic
918950737 1:191133181-191133203 CTAGTAAGAGGAAGAGTTTGAGG - Intergenic
919570005 1:199236483-199236505 CTAATAAGAGATAGAAATGTGGG - Intergenic
919846339 1:201644748-201644770 CTCAAAAGAAGCAGAATTTCAGG + Intronic
921424986 1:214991102-214991124 CAAAAAAAAGGGAGAATTTTTGG - Intergenic
923167046 1:231375579-231375601 TTTATAAGCAGCAGAATTTTTGG + Intronic
923610179 1:235484925-235484947 CTAACAAGAAGTAGGATTTTTGG - Intronic
1065047935 10:21760873-21760895 CTACAAAGAGGCAGTATTTTAGG + Intronic
1071308145 10:84317882-84317904 CTACTAAGATGCTGACTTTTGGG - Intergenic
1071723011 10:88166320-88166342 TTAATAAGAAGTAGACTTTTGGG - Intergenic
1071964832 10:90842113-90842135 GTATTAAGAGGCAGACTTTTGGG + Intronic
1073732610 10:106308087-106308109 CTAATAATAGGCAAGACTTTGGG - Intergenic
1079425035 11:20332347-20332369 CAAATTAAAGGCAGATTTTTGGG - Intergenic
1080839989 11:35975217-35975239 CTAATAAAATACAGAATTTCGGG - Intronic
1087762853 11:102120890-102120912 CTAATAAGGAGCAGGCTTTTGGG + Intronic
1087957604 11:104308047-104308069 CTTATAAGAAGAAGAAATTTGGG + Intergenic
1089552784 11:119293676-119293698 CTAAGAAGAGACAGGAATTTTGG - Intronic
1091518164 12:1208162-1208184 CTACTAAGTGGCAGAATCTAGGG + Intronic
1092117286 12:6018573-6018595 CTCATCAGAGGCAGGATTTCCGG + Exonic
1092170813 12:6372865-6372887 TTAAAAAGAGGCAGAGTTTTGGG + Intronic
1092904854 12:13091883-13091905 CTGATAAGAGGCAGATTAATAGG - Intronic
1095639397 12:44469549-44469571 AGAATAAGAAACAGAATTTTAGG - Intergenic
1096907643 12:54949733-54949755 CTATAAAGATGCAAAATTTTGGG + Intronic
1098019394 12:66136621-66136643 CTCATAAGAAGAAGAAATTTGGG + Intronic
1100370303 12:93963241-93963263 CTGACAAGAGGCAGATTTATAGG - Intergenic
1100677002 12:96879076-96879098 CAGATAAGAGGCAGAATCTCTGG - Intergenic
1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG + Intergenic
1103457552 12:121077965-121077987 TCAATAATAGGCAGAAATTTAGG + Intergenic
1104315189 12:127692191-127692213 CTATTCAGAGGGAGAAATTTTGG + Intergenic
1106099974 13:26685979-26686001 CTGAAAAGACCCAGAATTTTTGG - Exonic
1106523229 13:30516926-30516948 ATAATAAGGTTCAGAATTTTAGG + Intronic
1107326616 13:39250500-39250522 CTAATCAGAGTTATAATTTTTGG - Intergenic
1107667086 13:42702207-42702229 GTAAATAAAGGCAGAATTTTAGG - Intergenic
1107989812 13:45809936-45809958 CTAAACAGAGGCAGATTTCTTGG - Intronic
1108061374 13:46536778-46536800 CTGATAAGAGGCAGATTAATAGG + Intergenic
1108474969 13:50806538-50806560 CTAATATGAGTCAGAATTTAGGG - Intronic
1108716695 13:53086334-53086356 TTATTAAAAGGCAGAATCTTAGG + Intergenic
1108792560 13:53989449-53989471 CAAATAAAAAACAGAATTTTTGG + Intergenic
1108867485 13:54940239-54940261 CTAAAATGAGGGAGACTTTTTGG + Intergenic
1109197469 13:59394519-59394541 ATAATAAGAGGCTGAATGTAAGG - Intergenic
1109253954 13:60055067-60055089 CAAATTATAGGCAGAGTTTTTGG - Intronic
1110637749 13:77786245-77786267 CTGATAAGATGCAGGACTTTAGG - Intergenic
1111129564 13:83957088-83957110 CTAATCAGTGGCAGAAATATTGG - Intergenic
1111130485 13:83968784-83968806 TTAAAAAGAAGCAGAAATTTGGG + Intergenic
1111822752 13:93233646-93233668 CAAATCAGAGGCAGAATAATGGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114831328 14:26145615-26145637 CTATTAAGAGGTAGAACATTTGG + Intergenic
1114895231 14:26981401-26981423 CTAATGATGAGCAGAATTTTTGG + Intergenic
1115834304 14:37380859-37380881 TTAGTAGGAGGCTGAATTTTAGG + Intronic
1115935881 14:38551759-38551781 CTAAAAAGAGGCTCTATTTTGGG + Intergenic
1117626031 14:57639000-57639022 TAAACAAAAGGCAGAATTTTGGG - Intronic
1120241956 14:81959899-81959921 AAAATAAAATGCAGAATTTTAGG + Intergenic
1120928321 14:89820688-89820710 CAAATAAGAGGCTGCAGTTTGGG - Intronic
1121204965 14:92156393-92156415 CTAGTAGGTGGCATAATTTTTGG - Intronic
1125278321 15:38017245-38017267 GTATTAGGAGGCAGAAGTTTTGG - Intergenic
1127545221 15:59987660-59987682 CTATCATGAGGCAGAATTTGGGG + Intergenic
1129565777 15:76621778-76621800 TGAATCAGAGCCAGAATTTTTGG + Exonic
1131332317 15:91513375-91513397 CTAAGAAGAGGCAGCAATATAGG + Intergenic
1132923227 16:2411070-2411092 CTAGTAAGGGGCAGTACTTTGGG + Intergenic
1135396904 16:22138527-22138549 CTAATAACACGCAGAAGATTTGG + Intronic
1137739508 16:50753915-50753937 CTAATTAGAGGCAGGTTTCTGGG + Intronic
1137954078 16:52811166-52811188 CTTAGAAGAGGAAGAATATTTGG - Intergenic
1138061792 16:53899004-53899026 GTAATAAGAGGTAATATTTTAGG - Intronic
1138931391 16:61661422-61661444 CTAATAATAGGAAGAAATTTGGG + Intronic
1140047433 16:71451240-71451262 AAAATATGAGGCAGCATTTTGGG - Intronic
1140309210 16:73832878-73832900 CTGATAAGTGTCAGAAATTTGGG + Intergenic
1140340474 16:74154256-74154278 CTATTAAGATACAGAATATTTGG + Intergenic
1141399000 16:83730387-83730409 ATAATTAGAGGAAGAATTTCTGG + Intronic
1144032861 17:11337540-11337562 CTACAAAGAGGCAGAGTTCTTGG + Intronic
1144189862 17:12834728-12834750 CTCAGAAGAGGCATAATATTAGG + Intronic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1145403538 17:22567223-22567245 CTAAAAAGTGTCAGAATTATAGG + Intergenic
1145734825 17:27220783-27220805 CTAATAACTGGCAGAAGTATGGG + Intergenic
1146628923 17:34456061-34456083 TGAAGAAGAGGCAGAATTTAGGG + Intergenic
1147511569 17:41073687-41073709 AAAATAAGAGGCATAATTTTAGG + Intergenic
1149586303 17:57789875-57789897 ATAAAGAGAGGCAGTATTTTAGG - Intergenic
1151107300 17:71631177-71631199 CTACAAAGGGGCACAATTTTGGG + Intergenic
1155445619 18:25909493-25909515 CTAATAACAGAAAGAAATTTGGG - Intergenic
1155835640 18:30580576-30580598 TTAACAAGGGTCAGAATTTTTGG + Intergenic
1155881525 18:31155117-31155139 CAAATAAGTGACAGAATTTGTGG - Intronic
1158198256 18:54911412-54911434 CTAAGAAGAGGCACAATTCAAGG - Intronic
1158643591 18:59223044-59223066 CTACTAAGAAGTAGTATTTTTGG - Intronic
1159174024 18:64811379-64811401 CCAGTAAGGGGCAGATTTTTTGG + Intergenic
1159201613 18:65193242-65193264 TCAATAAGAGGCAGATTGTTTGG - Intergenic
1159253538 18:65914512-65914534 CTAATAAGAGGAAGAAGCTATGG - Intergenic
1159450332 18:68593357-68593379 TTAATAAAAAGCAGAAGTTTTGG + Intergenic
1159814448 18:73055200-73055222 TTATTAAGAGACAGAGTTTTCGG - Intergenic
1159868082 18:73729627-73729649 ATTAAAAGAGGCAGAATTTTAGG - Intergenic
1162667396 19:12225500-12225522 CTAATAAGAGGCAGAGGTGCTGG + Intronic
1165076895 19:33284478-33284500 CCATCTAGAGGCAGAATTTTTGG + Intergenic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
1166311833 19:41967379-41967401 CTAACGAGAGGCAGAGTTTCAGG + Intronic
1166378309 19:42341129-42341151 CTAATTAAAAACAGAATTTTTGG + Intronic
1166816065 19:45546967-45546989 ACAATAAGAAGCAGAGTTTTAGG - Intronic
925621263 2:5795128-5795150 ATAATTAGAGTCAAAATTTTTGG + Intergenic
925985672 2:9212968-9212990 CTAATTTAAGTCAGAATTTTAGG - Intronic
926235504 2:11040190-11040212 CTCATCAGAGACAGAATTATGGG + Intergenic
926462170 2:13144317-13144339 TTTATATGAGGCAAAATTTTTGG + Intergenic
927406290 2:22773106-22773128 CTTATAAGAGTAAAAATTTTTGG - Intergenic
928726284 2:34177460-34177482 ATGATATGAGGCAGGATTTTTGG + Intergenic
930530590 2:52583374-52583396 TTAAAAAGAAGCAGAATGTTTGG - Intergenic
934101503 2:88657488-88657510 CTGAGAAGAGGAAGAATTCTGGG + Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
935796381 2:106645251-106645273 CTTATAAGAGGAGGAAATTTGGG - Intergenic
938193818 2:129308042-129308064 CTATTAAGAGGCAGCATTGGCGG + Intergenic
939039572 2:137172095-137172117 CTAATAAGACGTATATTTTTTGG + Intronic
939184074 2:138840222-138840244 CTATTGATAGGCAGAATGTTAGG - Intergenic
939546248 2:143557691-143557713 CTATTAATAGGGAAAATTTTGGG + Intronic
939986203 2:148831935-148831957 GTAACCAGAGGCAGAATTCTGGG + Intergenic
944288888 2:197981670-197981692 CTAATAACAGACAGACATTTCGG - Intronic
944538301 2:200732906-200732928 CTAATAGGATGCAGCACTTTGGG + Intergenic
944642083 2:201737998-201738020 CTATTAAAATACAGAATTTTTGG + Intronic
944817156 2:203389438-203389460 CAAATAACAGGTAGTATTTTAGG + Intronic
945159157 2:206871399-206871421 CTAATTACATGCAGAATTTGGGG + Intergenic
945827395 2:214740104-214740126 CTAATAATTAGGAGAATTTTTGG - Intronic
1169990472 20:11497639-11497661 CTAAAAAGTGGCAGAATACTAGG - Intergenic
1171224731 20:23432474-23432496 CTAATAAAAAGAAGAATATTTGG - Intergenic
1171561689 20:26132703-26132725 CTAAAAAGTGTCAGAATTATAGG + Intergenic
1177153124 21:17474692-17474714 CTAACAGGAGGGAGAAGTTTGGG - Intergenic
1178723191 21:35028206-35028228 CTATTAAGATGCAGATTCTTGGG + Intronic
1180568720 22:16696986-16697008 CTTATCAGAGGCAGGATTTCTGG + Intergenic
1180728579 22:17964199-17964221 CTGAGGAGAGGCAGATTTTTTGG - Intronic
1182285161 22:29242394-29242416 GTGATAAGATGGAGAATTTTAGG - Intronic
1182671058 22:31996449-31996471 CTAAGAAGAGGAGGAATTCTAGG + Intergenic
1182731826 22:32502162-32502184 CTAATAGAAGGCAGCACTTTTGG - Intergenic
1182945531 22:34317936-34317958 CTAATTAGAGGCACAATTTGTGG - Intergenic
949881086 3:8661449-8661471 CTTAGAGGAGGCAGAAGTTTAGG - Intronic
951065538 3:18260891-18260913 CACATAAGAGGCAGAACTATTGG + Intronic
951072670 3:18350917-18350939 CTCAACAGAGGTAGAATTTTAGG + Intronic
954237794 3:49270287-49270309 CTAATAAGAGGAAGGAATATGGG - Exonic
954545332 3:51429471-51429493 CTATTAAGATGCAAAATATTGGG + Intronic
955392979 3:58534697-58534719 CTATGCAGTGGCAGAATTTTAGG + Intronic
955616337 3:60811296-60811318 CTACTAAGATTCTGAATTTTGGG + Intronic
957462246 3:80536218-80536240 CTAATAAGAGCCATCATCTTTGG - Intergenic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
958180180 3:90049810-90049832 CTTATAAGAGGCAAGTTTTTGGG - Intergenic
959479083 3:106849251-106849273 CTTATAAGAGGCAGAACCTAGGG - Intergenic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
960488487 3:118281563-118281585 CTAACAAGAGGCAGAAGTAAAGG - Intergenic
960747338 3:120904599-120904621 CTTATAAGAAGCGGAAATTTAGG + Intergenic
962982078 3:140499713-140499735 ATAACAAGAGGCAGAACTTCAGG - Intronic
963177323 3:142313731-142313753 CTAATAAGATTCAGAAAATTAGG + Intronic
965284506 3:166800950-166800972 CTAATAATTGGCAAAATTATTGG + Intergenic
965375738 3:167921490-167921512 TTAATGAGTGGCAGAATTATCGG + Intergenic
965377318 3:167941609-167941631 AGATAAAGAGGCAGAATTTTAGG - Intergenic
966104335 3:176317939-176317961 CTATTAAGAGAGAGAATCTTAGG + Intergenic
967451445 3:189628206-189628228 GAAAAAAGAGGGAGAATTTTTGG + Intergenic
967491216 3:190093018-190093040 CTAATAAAGGGAGGAATTTTGGG - Intronic
970222924 4:13828761-13828783 TTTATATGAGGCAGTATTTTGGG + Intergenic
970253017 4:14136513-14136535 CTAATATGATGCATTATTTTAGG + Intergenic
970625858 4:17880453-17880475 CTAAAAATAGGCAGTATGTTTGG - Intronic
971056230 4:22915716-22915738 CTAAAAATAGGCAGAAATTTGGG + Intergenic
972675207 4:41253923-41253945 ATAATAAATGGCAGAATTTTGGG - Intergenic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
975673755 4:76806708-76806730 CTATTAACAGGCAGCCTTTTGGG + Intergenic
976815831 4:89148138-89148160 CTCAGAAGAGGCAGAAGTGTGGG + Intergenic
977180198 4:93864895-93864917 CTTATATGAGGGAGAATATTTGG - Intergenic
978937242 4:114392829-114392851 CTGAGGAGAGGCAGAATTCTGGG + Intergenic
979796256 4:124850356-124850378 CTTATAAGAGGAAGACATTTGGG - Intergenic
980310455 4:131123156-131123178 CTAATAAGAAGAAGAATTACTGG + Intergenic
980636557 4:135512080-135512102 CTAATAAGTGAAAGAATTTTAGG - Intergenic
981305613 4:143244082-143244104 CTAACAAGAGAGAGAATTTGGGG - Intergenic
981423376 4:144577009-144577031 CTAACAAATGGCAGATTTTTAGG - Intergenic
984347266 4:178544897-178544919 TTTACAAGAAGCAGAATTTTAGG - Intergenic
984996265 4:185433599-185433621 CTATTAAGAGTGAGGATTTTTGG + Intronic
986252957 5:6077722-6077744 GTAAGTAGAGGCAGAGTTTTTGG - Intergenic
986831429 5:11583358-11583380 CTAAGAACAGGCAGAAATCTAGG + Intronic
987432554 5:17854098-17854120 AAAAAAAGAGGCAGACTTTTCGG - Intergenic
987833060 5:23123864-23123886 TTGATAAGAGGCAGGACTTTTGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989341466 5:40380104-40380126 GTATTAAGAGGTAGAATCTTTGG - Intergenic
990903978 5:60783285-60783307 TTTATCAGAGGAAGAATTTTAGG - Intronic
992657759 5:78927639-78927661 CCAATCAGAGGCAGAATTGGTGG - Intronic
993536538 5:89093537-89093559 TTAAAAAGAGGCAGAATTGAAGG + Intergenic
994647059 5:102483420-102483442 CTATTAAGAGGCACACTTTTTGG - Intronic
996261805 5:121480595-121480617 GAAATAATAGACAGAATTTTAGG + Intergenic
996354343 5:122579724-122579746 ACAAGAAGAGGCAGAATTTTGGG - Intergenic
998238460 5:140420880-140420902 TTAATATGATGCAGAATTTGTGG + Intronic
999594334 5:153185382-153185404 CTAAGAAGAGTCACGATTTTGGG - Intergenic
1003682939 6:8273719-8273741 CTATAAAGGGGCAGTATTTTTGG + Intergenic
1005424394 6:25686227-25686249 ATATTAAGGAGCAGAATTTTTGG + Intronic
1005954243 6:30652544-30652566 CTAATATGTAGCAGAATTTAGGG + Intronic
1008924408 6:56876922-56876944 CTAAGAAGAGACAGGAATTTAGG - Intronic
1008939852 6:57034920-57034942 ATAATAAGAAGAAGAAATTTTGG - Intergenic
1009467920 6:63995853-63995875 CTGATAAGAGGAATAAATTTTGG + Intronic
1009881761 6:69576084-69576106 CAAATAATAGGCATATTTTTAGG - Intergenic
1009958377 6:70485919-70485941 TTAATTAGACTCAGAATTTTAGG - Intronic
1010060956 6:71622150-71622172 ATAATAAGCGGCAGAATATTTGG + Intergenic
1010658902 6:78545657-78545679 TTAATAAGAGGCAGAATTCAGGG - Intergenic
1013450727 6:110277968-110277990 CTTATAACAGGCAAAATTTGAGG - Intronic
1013697724 6:112724072-112724094 CTAATAAGAGGCAGAGAGCTTGG + Intergenic
1013815830 6:114096104-114096126 CTATTAAGAAGGATAATTTTAGG + Intronic
1014112887 6:117639766-117639788 CTAAGAACAGGCACAATTTTTGG + Intergenic
1015904161 6:138099184-138099206 CTAATAACATGCAGATTCTTGGG - Intronic
1021144769 7:17071416-17071438 CTTATAAGAATGAGAATTTTTGG - Intergenic
1022049237 7:26649227-26649249 TTAATATGGGGCAGAATCTTTGG + Intergenic
1022691667 7:32662271-32662293 ATACTAGGAGGCAGAATTGTAGG - Intergenic
1024561216 7:50647011-50647033 CTAAAAAGAGGCAGAAAGTGTGG + Intronic
1025276189 7:57583001-57583023 CTAAAAAGTGTCAGAATTATAGG - Intergenic
1026197131 7:68182869-68182891 CTAGTAAGAGGCAGAGGCTTTGG - Intergenic
1027423065 7:78035702-78035724 CAAATAAGAGGGTGTATTTTAGG - Intronic
1028669789 7:93388074-93388096 CTGAGAAGAGGTAGAAATTTAGG - Intergenic
1028703900 7:93815637-93815659 ATAAGAAGAGGGAAAATTTTTGG + Intronic
1030421061 7:109306790-109306812 CTATTAAGAGGTAGAGTTTTGGG - Intergenic
1031351093 7:120731894-120731916 ATTATAAGTGGCAGAATTGTGGG + Intronic
1031916055 7:127564068-127564090 TTAATAAAAGGCAGGATTTAGGG + Intergenic
1033374071 7:140740563-140740585 CTCAAAAGAGGCAAAATATTAGG - Intronic
1034100949 7:148449977-148449999 CTAACAAAAGGCAGATTATTAGG - Intergenic
1034788496 7:153946828-153946850 CCAAAAAGATGGAGAATTTTAGG + Intronic
1036000034 8:4592210-4592232 ATAATAAGAGGCACAATTAAAGG - Intronic
1036114597 8:5945264-5945286 CTAAAAATAGGAAGTATTTTAGG + Intergenic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1036937185 8:13014576-13014598 GTATTAGGAGGCAGAACTTTAGG - Intronic
1037182764 8:16027089-16027111 GTAATAAGAGGCGGCACTTTGGG - Intergenic
1038927208 8:32154011-32154033 CAAATAACAGGCAGATTCTTTGG + Intronic
1039261785 8:35779773-35779795 TTATTAAGAGGCAGGTTTTTAGG - Intronic
1039950051 8:42163701-42163723 GTAATAGAAGTCAGAATTTTGGG + Intronic
1041156462 8:54992278-54992300 GTACTAACAGGTAGAATTTTTGG - Intergenic
1042463993 8:69105319-69105341 CTAATGAGTAGCAGAATTTCAGG - Intergenic
1043283488 8:78499951-78499973 GTAATAAAATGTAGAATTTTAGG - Intergenic
1045182386 8:99798413-99798435 TAAATCAGAGGCAGAAGTTTAGG + Intronic
1045605474 8:103768799-103768821 GTAATAAGACGCTGAATTTTGGG - Intronic
1045981602 8:108195757-108195779 CTAATAAGAGCCAGACATTAGGG + Intergenic
1046146448 8:110167132-110167154 TTAAAAAGAGGCAGGACTTTTGG + Intergenic
1046251636 8:111639992-111640014 ATAATAAAAGGCATAATTTAGGG - Intergenic
1046758779 8:117998586-117998608 CTTAAAAAATGCAGAATTTTAGG - Intronic
1048454604 8:134566484-134566506 CTAATCAGAGGCAAAATGTAGGG - Intronic
1050135412 9:2458365-2458387 CTAGGAAGAGGCAGACTATTGGG - Intergenic
1050700316 9:8331345-8331367 CTAATAGGAAGCAAATTTTTTGG + Intronic
1051193775 9:14541572-14541594 CTAATAAGAAACATAAATTTGGG + Intergenic
1051393439 9:16591778-16591800 CAAATAAGAGACATACTTTTAGG - Intronic
1053190429 9:36061803-36061825 CTTATAATATGCAGTATTTTTGG + Intronic
1053309004 9:37003540-37003562 CTAATAAGAGGCAGAGTGCCTGG + Intronic
1059874054 9:118613360-118613382 CTAATTAGAGACATAATTTTGGG - Intergenic
1060356917 9:122917419-122917441 CAAATAAGACTTAGAATTTTAGG + Exonic
1188402296 X:29760527-29760549 CTTAAAAGATGCAGACTTTTGGG + Intronic
1188757332 X:33978448-33978470 AGAATAAGAGGCAGATTTTCAGG - Intergenic
1191071347 X:56403678-56403700 CTATTAACAGGCATAATTTGAGG + Intergenic
1193643088 X:84035607-84035629 TTAAGAAGTGGCATAATTTTTGG - Intergenic
1194942633 X:100030143-100030165 CTAACTAAAGGCAGAATTTAAGG - Intergenic
1194955686 X:100177290-100177312 ATATGAAGAGGAAGAATTTTGGG + Intergenic
1195042742 X:101029102-101029124 CAAATAAGAGGAAGAATAGTAGG - Intronic
1197099414 X:122635435-122635457 CTAATAATAAACAGAAATTTTGG - Intergenic
1199196216 X:145033861-145033883 CTAATAACATGAGGAATTTTGGG - Intergenic