ID: 1101519098

View in Genome Browser
Species Human (GRCh38)
Location 12:105465174-105465196
Sequence TGGGATTCTCCTAGAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101519098_1101519099 -9 Left 1101519098 12:105465174-105465196 CCAGGTTTTCTAGGAGAATCCCA No data
Right 1101519099 12:105465188-105465210 AGAATCCCATTTCAACATTCTGG No data
1101519098_1101519102 29 Left 1101519098 12:105465174-105465196 CCAGGTTTTCTAGGAGAATCCCA No data
Right 1101519102 12:105465226-105465248 AGCCATCTAAATATCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101519098 Original CRISPR TGGGATTCTCCTAGAAAACC TGG (reversed) Intergenic
No off target data available for this crispr