ID: 1101521903

View in Genome Browser
Species Human (GRCh38)
Location 12:105491602-105491624
Sequence GTGAAAACACAGATGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101521903_1101521905 6 Left 1101521903 12:105491602-105491624 CCCAGGTTCATCTGTGTTTTCAC No data
Right 1101521905 12:105491631-105491653 CAGAATTTCCTCCTTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101521903 Original CRISPR GTGAAAACACAGATGAACCT GGG (reversed) Intergenic
No off target data available for this crispr