ID: 1101526465

View in Genome Browser
Species Human (GRCh38)
Location 12:105535651-105535673
Sequence CAAAATGCTGATAGGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101526465_1101526470 4 Left 1101526465 12:105535651-105535673 CCCATATCCCTATCAGCATTTTG No data
Right 1101526470 12:105535678-105535700 AACCCATTCAACAAGTCTCTAGG 0: 22
1: 1792
2: 2053
3: 1362
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101526465 Original CRISPR CAAAATGCTGATAGGGATAT GGG (reversed) Intergenic
No off target data available for this crispr