ID: 1101529375

View in Genome Browser
Species Human (GRCh38)
Location 12:105560137-105560159
Sequence GGATCTCTGAGTATGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101529375_1101529379 16 Left 1101529375 12:105560137-105560159 CCATCTGGCATACTCAGAGATCC No data
Right 1101529379 12:105560176-105560198 GACTCTAGGAGAAAATAGTGCGG No data
1101529375_1101529378 2 Left 1101529375 12:105560137-105560159 CCATCTGGCATACTCAGAGATCC No data
Right 1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG No data
1101529375_1101529380 30 Left 1101529375 12:105560137-105560159 CCATCTGGCATACTCAGAGATCC No data
Right 1101529380 12:105560190-105560212 ATAGTGCGGACCCCTTTTGCTGG No data
1101529375_1101529376 -6 Left 1101529375 12:105560137-105560159 CCATCTGGCATACTCAGAGATCC No data
Right 1101529376 12:105560154-105560176 AGATCCAGCTGAAAAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101529375 Original CRISPR GGATCTCTGAGTATGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr