ID: 1101529378

View in Genome Browser
Species Human (GRCh38)
Location 12:105560162-105560184
Sequence CTGAAAAATAGAAGGACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101529374_1101529378 14 Left 1101529374 12:105560125-105560147 CCTCTTCACACTCCATCTGGCAT No data
Right 1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG No data
1101529372_1101529378 23 Left 1101529372 12:105560116-105560138 CCTGCTTCTCCTCTTCACACTCC No data
Right 1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG No data
1101529375_1101529378 2 Left 1101529375 12:105560137-105560159 CCATCTGGCATACTCAGAGATCC No data
Right 1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101529378 Original CRISPR CTGAAAAATAGAAGGACTCT AGG Intergenic
No off target data available for this crispr