ID: 1101531813

View in Genome Browser
Species Human (GRCh38)
Location 12:105580484-105580506
Sequence TGCCTAATACAACCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101531811_1101531813 -1 Left 1101531811 12:105580462-105580484 CCCAAGTGATGTCTAGCTATGTT No data
Right 1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG No data
1101531808_1101531813 17 Left 1101531808 12:105580444-105580466 CCATTTCCTACCTCTTAGCCCAA No data
Right 1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG No data
1101531810_1101531813 7 Left 1101531810 12:105580454-105580476 CCTCTTAGCCCAAGTGATGTCTA No data
Right 1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG No data
1101531809_1101531813 11 Left 1101531809 12:105580450-105580472 CCTACCTCTTAGCCCAAGTGATG No data
Right 1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG No data
1101531812_1101531813 -2 Left 1101531812 12:105580463-105580485 CCAAGTGATGTCTAGCTATGTTG No data
Right 1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101531813 Original CRISPR TGCCTAATACAACCCCAAAG AGG Intergenic
No off target data available for this crispr