ID: 1101533727

View in Genome Browser
Species Human (GRCh38)
Location 12:105598296-105598318
Sequence ACTCACATAATGAAGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101533726_1101533727 -4 Left 1101533726 12:105598277-105598299 CCTCAATTAGAGTTTACTGACTC No data
Right 1101533727 12:105598296-105598318 ACTCACATAATGAAGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101533727 Original CRISPR ACTCACATAATGAAGAAGTC CGG Intergenic
No off target data available for this crispr