ID: 1101537746

View in Genome Browser
Species Human (GRCh38)
Location 12:105634908-105634930
Sequence CATTCTGGGCAGAAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101537743_1101537746 -9 Left 1101537743 12:105634894-105634916 CCTGATGGACTCTACATTCTGGG No data
Right 1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101537746 Original CRISPR CATTCTGGGCAGAAAGTGGC AGG Intergenic
No off target data available for this crispr