ID: 1101538067

View in Genome Browser
Species Human (GRCh38)
Location 12:105638798-105638820
Sequence TGTTAGGGTTACAGCTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101538067_1101538072 20 Left 1101538067 12:105638798-105638820 CCACTCTAGCTGTAACCCTAACA No data
Right 1101538072 12:105638841-105638863 ATATCCTCTTTGTTCTTTAAGGG No data
1101538067_1101538071 19 Left 1101538067 12:105638798-105638820 CCACTCTAGCTGTAACCCTAACA No data
Right 1101538071 12:105638840-105638862 TATATCCTCTTTGTTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101538067 Original CRISPR TGTTAGGGTTACAGCTAGAG TGG (reversed) Intergenic
No off target data available for this crispr