ID: 1101539485

View in Genome Browser
Species Human (GRCh38)
Location 12:105652167-105652189
Sequence AAAGCCTAGTGAATCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101539483_1101539485 2 Left 1101539483 12:105652142-105652164 CCTCTTATTACAAAGAAGAGAGC No data
Right 1101539485 12:105652167-105652189 AAAGCCTAGTGAATCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101539485 Original CRISPR AAAGCCTAGTGAATCTCTTT GGG Intergenic
No off target data available for this crispr