ID: 1101542604

View in Genome Browser
Species Human (GRCh38)
Location 12:105678516-105678538
Sequence TTGTAATCTCAATGGCTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101542604_1101542609 -6 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542609 12:105678533-105678555 TTACAAAGGAGGTGACCACTAGG No data
1101542604_1101542610 -2 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542610 12:105678537-105678559 AAAGGAGGTGACCACTAGGAAGG No data
1101542604_1101542613 5 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG No data
1101542604_1101542611 1 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542611 12:105678540-105678562 GGAGGTGACCACTAGGAAGGAGG No data
1101542604_1101542612 2 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542612 12:105678541-105678563 GAGGTGACCACTAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101542604 Original CRISPR TTGTAATCTCAATGGCTATT GGG (reversed) Intergenic
No off target data available for this crispr