ID: 1101542608

View in Genome Browser
Species Human (GRCh38)
Location 12:105678524-105678546
Sequence CACCTCCTTTGTAATCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101542608_1101542612 -6 Left 1101542608 12:105678524-105678546 CCATTGAGATTACAAAGGAGGTG No data
Right 1101542612 12:105678541-105678563 GAGGTGACCACTAGGAAGGAGGG No data
1101542608_1101542611 -7 Left 1101542608 12:105678524-105678546 CCATTGAGATTACAAAGGAGGTG No data
Right 1101542611 12:105678540-105678562 GGAGGTGACCACTAGGAAGGAGG No data
1101542608_1101542610 -10 Left 1101542608 12:105678524-105678546 CCATTGAGATTACAAAGGAGGTG No data
Right 1101542610 12:105678537-105678559 AAAGGAGGTGACCACTAGGAAGG No data
1101542608_1101542613 -3 Left 1101542608 12:105678524-105678546 CCATTGAGATTACAAAGGAGGTG No data
Right 1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101542608 Original CRISPR CACCTCCTTTGTAATCTCAA TGG (reversed) Intergenic
No off target data available for this crispr