ID: 1101542609

View in Genome Browser
Species Human (GRCh38)
Location 12:105678533-105678555
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101542605_1101542609 -7 Left 1101542605 12:105678517-105678539 CCAATAGCCATTGAGATTACAAA No data
Right 1101542609 12:105678533-105678555 TTACAAAGGAGGTGACCACTAGG No data
1101542604_1101542609 -6 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542609 12:105678533-105678555 TTACAAAGGAGGTGACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101542609 Original CRISPR TTACAAAGGAGGTGACCACT AGG Intergenic
No off target data available for this crispr