ID: 1101542613

View in Genome Browser
Species Human (GRCh38)
Location 12:105678544-105678566
Sequence GTGACCACTAGGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101542605_1101542613 4 Left 1101542605 12:105678517-105678539 CCAATAGCCATTGAGATTACAAA No data
Right 1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG No data
1101542608_1101542613 -3 Left 1101542608 12:105678524-105678546 CCATTGAGATTACAAAGGAGGTG No data
Right 1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG No data
1101542604_1101542613 5 Left 1101542604 12:105678516-105678538 CCCAATAGCCATTGAGATTACAA No data
Right 1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101542613 Original CRISPR GTGACCACTAGGAAGGAGGG TGG Intergenic
No off target data available for this crispr