ID: 1101542735

View in Genome Browser
Species Human (GRCh38)
Location 12:105679985-105680007
Sequence TCAGTGTCCTCACCTTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101542735_1101542736 13 Left 1101542735 12:105679985-105680007 CCTGATGAAGGTGAGGACACTGA No data
Right 1101542736 12:105680021-105680043 GATGAATCTTTTTTGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101542735 Original CRISPR TCAGTGTCCTCACCTTCATC AGG (reversed) Intergenic