ID: 1101543960

View in Genome Browser
Species Human (GRCh38)
Location 12:105692471-105692493
Sequence GAATGACATCGATAACTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101543958_1101543960 19 Left 1101543958 12:105692429-105692451 CCATATGAATTTTAGGATAGTTT 0: 25
1: 822
2: 2917
3: 5026
4: 17101
Right 1101543960 12:105692471-105692493 GAATGACATCGATAACTTAATGG No data
1101543959_1101543960 -9 Left 1101543959 12:105692457-105692479 CCTAACTCTGTAAAGAATGACAT No data
Right 1101543960 12:105692471-105692493 GAATGACATCGATAACTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101543960 Original CRISPR GAATGACATCGATAACTTAA TGG Intergenic
No off target data available for this crispr