ID: 1101545152

View in Genome Browser
Species Human (GRCh38)
Location 12:105705479-105705501
Sequence TGGGGTTTACAATTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101545146_1101545152 -1 Left 1101545146 12:105705457-105705479 CCAGTGTGTTCAGTGGGAGTGCT No data
Right 1101545152 12:105705479-105705501 TGGGGTTTACAATTGGAGGAAGG No data
1101545142_1101545152 23 Left 1101545142 12:105705433-105705455 CCGATGTGTGAACTTTTGGCATG No data
Right 1101545152 12:105705479-105705501 TGGGGTTTACAATTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101545152 Original CRISPR TGGGGTTTACAATTGGAGGA AGG Intergenic
No off target data available for this crispr