ID: 1101548486

View in Genome Browser
Species Human (GRCh38)
Location 12:105739439-105739461
Sequence ATGGACCAGTGGAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101548486_1101548493 16 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548493 12:105739478-105739500 TACGGCTATACCTGCCTGCAGGG No data
1101548486_1101548490 -2 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548490 12:105739460-105739482 ATTGGCCAGACTTAGTGTTACGG No data
1101548486_1101548492 15 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548492 12:105739477-105739499 TTACGGCTATACCTGCCTGCAGG No data
1101548486_1101548496 25 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548496 12:105739487-105739509 ACCTGCCTGCAGGGAAGGCTGGG No data
1101548486_1101548494 20 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548494 12:105739482-105739504 GCTATACCTGCCTGCAGGGAAGG No data
1101548486_1101548495 24 Left 1101548486 12:105739439-105739461 CCATCACACTTCCACTGGTCCAT No data
Right 1101548495 12:105739486-105739508 TACCTGCCTGCAGGGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101548486 Original CRISPR ATGGACCAGTGGAAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr