ID: 1101548629

View in Genome Browser
Species Human (GRCh38)
Location 12:105740696-105740718
Sequence GGTACATTGTTGAATGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101548620_1101548629 21 Left 1101548620 12:105740652-105740674 CCTGCATAGTTTTTGACCTAAAG No data
Right 1101548629 12:105740696-105740718 GGTACATTGTTGAATGCTGGGGG No data
1101548621_1101548629 5 Left 1101548621 12:105740668-105740690 CCTAAAGATCAAAACACTCAGCA No data
Right 1101548629 12:105740696-105740718 GGTACATTGTTGAATGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101548629 Original CRISPR GGTACATTGTTGAATGCTGG GGG Intergenic
No off target data available for this crispr