ID: 1101550765

View in Genome Browser
Species Human (GRCh38)
Location 12:105759466-105759488
Sequence CACCTGGGACTATCATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101550765_1101550769 -8 Left 1101550765 12:105759466-105759488 CCCCTGGATGATAGTCCCAGGTG No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101550765 Original CRISPR CACCTGGGACTATCATCCAG GGG (reversed) Intergenic
No off target data available for this crispr