ID: 1101550769

View in Genome Browser
Species Human (GRCh38)
Location 12:105759481-105759503
Sequence CCCAGGTGAGCATCCAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101550766_1101550769 -9 Left 1101550766 12:105759467-105759489 CCCTGGATGATAGTCCCAGGTGA No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data
1101550760_1101550769 21 Left 1101550760 12:105759437-105759459 CCAAGAAGCCATGTGAAGAAAAG No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data
1101550765_1101550769 -8 Left 1101550765 12:105759466-105759488 CCCCTGGATGATAGTCCCAGGTG No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data
1101550767_1101550769 -10 Left 1101550767 12:105759468-105759490 CCTGGATGATAGTCCCAGGTGAG No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data
1101550763_1101550769 -2 Left 1101550763 12:105759460-105759482 CCAAAGCCCCTGGATGATAGTCC No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data
1101550761_1101550769 13 Left 1101550761 12:105759445-105759467 CCATGTGAAGAAAAGCCAAAGCC No data
Right 1101550769 12:105759481-105759503 CCCAGGTGAGCATCCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101550769 Original CRISPR CCCAGGTGAGCATCCAGCTG AGG Intergenic
No off target data available for this crispr