ID: 1101551395

View in Genome Browser
Species Human (GRCh38)
Location 12:105765657-105765679
Sequence TGTTAAATTTAATTTGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 35, 1: 91, 2: 86, 3: 108, 4: 548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101551395_1101551396 13 Left 1101551395 12:105765657-105765679 CCTTAGACAAATTAAATTTAACA 0: 35
1: 91
2: 86
3: 108
4: 548
Right 1101551396 12:105765693-105765715 CAAAGAATGATTCGTGTATCAGG No data
1101551395_1101551397 28 Left 1101551395 12:105765657-105765679 CCTTAGACAAATTAAATTTAACA 0: 35
1: 91
2: 86
3: 108
4: 548
Right 1101551397 12:105765708-105765730 GTATCAGGCAGCCCCCAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101551395 Original CRISPR TGTTAAATTTAATTTGTCTA AGG (reversed) Intergenic
901470551 1:9453181-9453203 TATTAAATATAATTTGTCTAAGG + Intergenic
902952740 1:19899397-19899419 TTTTAAATTTAACATGTCTTGGG + Intronic
903062330 1:20678399-20678421 TTTTAAATTTTTTTTGTATAAGG - Intronic
904150247 1:28432723-28432745 TATTAAATCTTATTTTTCTAAGG + Intronic
904692950 1:32308469-32308491 AGTGAGATTTAATTTGTGTATGG + Intronic
905681817 1:39878287-39878309 TGTTAAAGGTATTGTGTCTATGG - Intronic
906440731 1:45841284-45841306 CATTAAATTTAACTTGTCTCAGG + Intronic
907082996 1:51642077-51642099 TGTGAAGTTTAATTTGTCTTTGG + Intronic
907103357 1:51857456-51857478 TGTTAAATTTAATATGTCTAAGG + Intronic
907227665 1:52964151-52964173 TTTGAAATTAAATTTGTTTATGG + Intronic
907748605 1:57240012-57240034 TTTAAAATTTTATCTGTCTAGGG + Intronic
907762390 1:57374102-57374124 TGTTTATTTTAATTTGTCACAGG - Intronic
908085446 1:60627401-60627423 TATTAAATCTTCTTTGTCTAAGG + Intergenic
908198270 1:61767579-61767601 TGTTAAATAGAATCTGTTTAAGG + Intronic
908265258 1:62372442-62372464 TTTTAAATGTAATTTGGCTAAGG + Intergenic
908843280 1:68299561-68299583 TCTTAAATTTAGTTTTTCTTTGG - Intergenic
908927918 1:69279000-69279022 TGTTAAGTTTAATTTGTCTAAGG - Intergenic
909766412 1:79361345-79361367 TGTTACATTTAATTGGGCTAGGG + Intergenic
909857566 1:80557653-80557675 TTTTCACTTTCATTTGTCTAAGG + Intergenic
910451387 1:87349646-87349668 TCTTAAATTCTATTTCTCTAAGG + Intergenic
910735320 1:90447462-90447484 TTTTAAAATTAATTTGGTTAAGG + Intergenic
910959440 1:92746270-92746292 TGTTAAATTTAATGTGTCTAAGG + Intronic
910975158 1:92898636-92898658 TGCTAATTTTTATTTGTTTACGG + Intronic
911471915 1:98329533-98329555 TTTTAATTTTAATTTTTTTAAGG + Intergenic
911513344 1:98835757-98835779 ATTTAAATTTAATTTTTCTCAGG - Intergenic
911786836 1:101961268-101961290 TGTTACATTTAATTTGTAAATGG + Intronic
911875576 1:103158204-103158226 TGTGAAATTTAATTTGTGTAAGG + Intergenic
914699761 1:150121223-150121245 TGTTAAACTTCATATGGCTATGG - Intronic
914929739 1:151920496-151920518 TGATAAATTTAATTTGTCTAAGG + Intergenic
916597609 1:166260022-166260044 TGTTAATTTATATTTGCCTAGGG + Intergenic
916734435 1:167594898-167594920 TGTTAAATTTAATTTGCCTAAGG - Intergenic
917215591 1:172675104-172675126 TTTTAGTTTTATTTTGTCTAGGG + Intergenic
917945563 1:179966992-179967014 TGTTAAATTTAATTTGTCTAAGG - Intronic
918767692 1:188509949-188509971 TGTTAAATTGGATTTGTCATTGG - Intergenic
918784297 1:188745568-188745590 TGTTACTTTTAATTTTTCAAAGG - Intergenic
919629543 1:199946743-199946765 TGTTAAATTTAATTTGTCTGAGG + Intergenic
919960730 1:202465764-202465786 TTTTAAACTTATTTTTTCTAAGG + Intronic
920772007 1:208895825-208895847 CATTAAATGTAAATTGTCTAAGG - Intergenic
920790721 1:209087818-209087840 TGTTATAATTATTTTGTTTAAGG - Intergenic
921208167 1:212867455-212867477 AGTTAAATCTAATTTGTCCAAGG + Intronic
921798159 1:219371871-219371893 TGTTAAATTTAATTTGTCTAAGG + Intergenic
921829935 1:219716250-219716272 TAATAAATGTAATTTGTATAAGG + Intronic
922126493 1:222730642-222730664 TGATAAATTTCAGTTGTGTAGGG + Intronic
922665215 1:227463225-227463247 AGTGAGATATAATTTGTCTATGG - Intergenic
922681319 1:227599188-227599210 TGTTAAATTTAACTGGTTTCAGG + Intronic
923636956 1:235707712-235707734 TATTAAAATTAATATTTCTATGG - Intronic
924099474 1:240588944-240588966 TTTTAATTTTAATTTTTATAGGG - Intronic
924195387 1:241601948-241601970 TGTTAAATTTGATGAGTCTGTGG + Intronic
924353259 1:243140345-243140367 TGTTAAATTTAATTCTTCCATGG + Intronic
924490947 1:244536778-244536800 TGTTAAATTTCATGTTCCTATGG + Intronic
924559821 1:245148616-245148638 TGTTAATTTTATTTTGTTTTGGG - Intergenic
924768221 1:247053823-247053845 TGTTAAATTTGTTGTGCCTATGG - Intronic
1063072248 10:2678328-2678350 TGTTATATTTTATTAGTTTAAGG + Intergenic
1063277993 10:4592523-4592545 TTTGAAATATAATTTTTCTATGG + Intergenic
1063397748 10:5707241-5707263 TGTTAAATTTATACTCTCTAAGG - Intronic
1063721971 10:8592754-8592776 TTTTAAATTTAGTTTAACTAAGG - Intergenic
1063751387 10:8952279-8952301 TGTATAATTTAATTTTTCTTAGG + Intergenic
1064236558 10:13581634-13581656 TTTTACATTTAATTTTTCTTTGG + Intergenic
1065011910 10:21428523-21428545 TATTTAATTTAATTTGTCTAAGG - Intergenic
1065060289 10:21893858-21893880 TGTTTAATTGATTTTCTCTATGG - Intronic
1065565641 10:27005865-27005887 TATTAAATATAATTTGCCCATGG + Intronic
1065576619 10:27126865-27126887 TCATAAATTTAATTTGGATATGG + Intronic
1066192100 10:33065532-33065554 TTGTTAAATTAATTTGTCTAAGG + Intergenic
1066976222 10:42370165-42370187 TACTAAATTTAATTTGTCTAAGG - Intergenic
1067246854 10:44554615-44554637 TGTGAAATTTATTTTTTCTTTGG - Intergenic
1067272074 10:44800963-44800985 TGTTAAATTTAATTTATCTAAGG - Intergenic
1067914995 10:50387699-50387721 TGTTAAATTTAATTTAGCTAAGG - Intronic
1068233940 10:54207757-54207779 TATGAAATTTAATCTGCCTAAGG - Intronic
1068358272 10:55940853-55940875 TTTTAAATTTAATTCAGCTAAGG - Intergenic
1068421364 10:56798489-56798511 TGTGAACTTTAATGTGACTAGGG + Intergenic
1068522331 10:58091456-58091478 TTTTAAATTAATTTTGTATAAGG - Intergenic
1068624668 10:59229548-59229570 CTTTAAATTTAATTTGGCTGAGG - Intronic
1069449658 10:68506102-68506124 TTTTAAATATAACTTGTCTTTGG - Intronic
1070252606 10:74786084-74786106 CGTTAAATTCAATTTGTCCAAGG - Intergenic
1070446421 10:76508919-76508941 ACTTAAATTTAATTTCTCTCTGG + Intronic
1070512499 10:77174191-77174213 TATTTAATTTAATTTGGGTAGGG + Intronic
1070822860 10:79372853-79372875 TGTTAAATTTAACTTGTCTAAGG - Intergenic
1071124373 10:82317172-82317194 TTTCAAATTCAATATGTCTAAGG + Intronic
1071821245 10:89283403-89283425 TACTAAATTTAATTTGTCTAAGG + Intronic
1071939382 10:90572111-90572133 TGTTAAATTTTATTTGTCCAAGG + Intergenic
1072079150 10:92011280-92011302 AGTTAAATTTAATATTTCTAAGG - Exonic
1072770245 10:98131986-98132008 TGGTAAATCTAAGGTGTCTATGG + Intergenic
1072971521 10:100021694-100021716 TGTTAAATTTAATTTGCCTAAGG + Intergenic
1073388188 10:103146223-103146245 TGTTTAATTTAACTTGTCATTGG + Intronic
1073795514 10:106983886-106983908 TGTTACCTTTAAGTTGTCTAGGG + Intronic
1073830994 10:107383392-107383414 TGTTAAATATGCTTTTTCTAAGG + Intergenic
1074337176 10:112589963-112589985 TTATAGATTTAATTTGTATAGGG + Intronic
1074478709 10:113797904-113797926 TGTTAAAATTATTTTGTACATGG - Intergenic
1075223129 10:120601600-120601622 TGTTAAATTGAATTTGTCTAAGG + Intergenic
1075873012 10:125784329-125784351 TCTCAAATGTAATTTGTCTAAGG + Intergenic
1075949421 10:126463953-126463975 TGTAAAATTTAAATTGGTTATGG - Intronic
1076154268 10:128191350-128191372 TATTATATTAAATTTGTATATGG + Intergenic
1076602220 10:131665198-131665220 CTTTAAATTTAATTTGGCTGAGG - Intergenic
1077312553 11:1896895-1896917 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1077527850 11:3078552-3078574 AAATAAATTTAATTTGGCTAAGG + Intergenic
1077879093 11:6333951-6333973 TGTTAAATTTAATTTTATTAGGG + Intergenic
1078220479 11:9347733-9347755 TTTTAAATTTAATTTTTATTAGG + Intergenic
1078541174 11:12214280-12214302 TGTTAAATAAAATCTGTATATGG + Intronic
1079219331 11:18545754-18545776 TGTTAAATATAAATTGTCAGGGG + Intronic
1079682879 11:23320965-23320987 TTATAAAATCAATTTGTCTATGG + Intergenic
1079758743 11:24301769-24301791 TTTTAAAGTTAGTGTGTCTAAGG + Intergenic
1079783840 11:24644779-24644801 TTTTAAAATTAGTTTGTCTGGGG + Intronic
1079932564 11:26583410-26583432 TGTTAAATTTCCTCTGTCCAAGG - Intronic
1080502571 11:32884827-32884849 TATTAAATTTAATTTGTCTGAGG + Intergenic
1080863865 11:36175814-36175836 TGTTAAGTTTAGTTGCTCTAGGG + Intronic
1081317950 11:41653680-41653702 TTTTTATTTTAATTTGTCAAGGG + Intergenic
1082683854 11:56214078-56214100 TGTTAAATTAAGGGTGTCTATGG - Intergenic
1082853047 11:57782378-57782400 TGTTAAATTTAATTTAGTTAAGG - Intronic
1083107391 11:60371795-60371817 TGTTAAATTCAATCAGTCTTAGG + Intronic
1083460868 11:62810820-62810842 TCATAAATTTATTTTGTATATGG + Intronic
1083537476 11:63483242-63483264 TGTTAAGTTTATTTGTTCTAGGG - Intronic
1084865717 11:72055344-72055366 AGTTAAGTTTACCTTGTCTAAGG + Intronic
1086042261 11:82493860-82493882 TGTTAAATTTAATTTGGCTAAGG + Intergenic
1086140903 11:83498888-83498910 TTTTAAATCTTATTTGTGTAAGG - Intronic
1086847935 11:91774630-91774652 TGTTAAATTTTGTTTTCCTAAGG + Intergenic
1087213376 11:95466768-95466790 TGGTAAATTATATTTTTCTAGGG + Intergenic
1087513392 11:99127227-99127249 TTTTAAATTTACTTTTTCAATGG - Intronic
1087543279 11:99548267-99548289 TGTGAAATTTAACTTGTCTAAGG - Intronic
1087616795 11:100495040-100495062 TGTTAAGTTCATTTGGTCTAGGG - Intergenic
1087887158 11:103494525-103494547 TGCTGAATTTAATACGTCTAAGG + Intergenic
1087973490 11:104515143-104515165 TGTTAATTTTGATTTTTGTAGGG + Intergenic
1088351062 11:108888233-108888255 TGTCAAATTAAATTTGAATAAGG + Intronic
1089242432 11:117093748-117093770 AGTTGGATTTAATTTGTATAGGG - Intronic
1089444933 11:118544327-118544349 TCTGGAATTTAATTTTTCTAAGG - Intronic
1089465320 11:118681246-118681268 GGTTAAATTTAATTTGTCTAAGG - Intergenic
1089941182 11:122419187-122419209 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1092127139 12:6082806-6082828 TGTTAAATTTAATTTGTCTCAGG + Intronic
1092521178 12:9274872-9274894 TATTAAATTTTATTTTTCAAAGG + Intergenic
1092632465 12:10396876-10396898 TTTTCTATATAATTTGTCTATGG + Intronic
1093105970 12:15087565-15087587 TGTTATATTTAATTTGTCTAAGG - Intergenic
1093538068 12:20247047-20247069 TGATAAATTTGATTTTCCTATGG - Intergenic
1094015070 12:25854144-25854166 TGTTCAATTTAATTTGTCTAAGG + Intergenic
1094401337 12:30063560-30063582 TATTAAATCTAATTTGTCTCAGG - Intergenic
1094732100 12:33188825-33188847 TTTTAAATTTAATTTTTAAAAGG + Intergenic
1095121862 12:38428617-38428639 TGTGAAATTCCATTTGTTTAGGG - Intergenic
1095161161 12:38917506-38917528 TGTGAAATTATATTTGCCTAAGG + Intergenic
1095235864 12:39794802-39794824 TGTTAAATTTAATTTGTCTAAGG + Intronic
1095269861 12:40205001-40205023 TATTAAAATTTATTTGTCAAAGG - Intronic
1095482302 12:42649220-42649242 CATTAAATTTAATTTAGCTAAGG - Intergenic
1095575142 12:43728176-43728198 TGTTAAACTTTTTTTGTTTAAGG - Intergenic
1097298229 12:57990225-57990247 TGCTAAATTTAAGTTGTCAAAGG - Intergenic
1097458826 12:59834484-59834506 TGTGAAATCTTATTTGTATAAGG - Intergenic
1097492913 12:60293190-60293212 GTTTAAATATTATTTGTCTAGGG + Intergenic
1097748032 12:63320669-63320691 TGTTAAATTTAATTAGCCTCAGG + Intergenic
1097799623 12:63899411-63899433 TGTTAAATTTAATTGGTCTAAGG - Intronic
1098176792 12:67800631-67800653 TGTTATATTTTATATGTCTTTGG - Intergenic
1098400353 12:70068716-70068738 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1098522651 12:71451026-71451048 TGTTAAGTTTAATTTGCCTAAGG - Intronic
1098606751 12:72400049-72400071 TGTTATATTCTTTTTGTCTAGGG + Intronic
1099291452 12:80781401-80781423 TATCAAATTTGATTTGTCTAAGG + Intergenic
1099387989 12:82041322-82041344 TCTTAAGTTTCATTTGTCTAAGG + Intergenic
1099478586 12:83139818-83139840 TTTTAAATGTATTTTGTCTTGGG + Intergenic
1099710783 12:86221870-86221892 TGCTAAATTTAATTTGTCTAAGG + Intronic
1099799162 12:87435393-87435415 AGTTAAATTTAATTTGGCTAAGG + Intergenic
1099881240 12:88469216-88469238 TGATAAATTCAATTTTTCAAAGG - Intergenic
1100159044 12:91836236-91836258 TGTTAAATGTAATTTGTCTAAGG - Intergenic
1100705443 12:97195568-97195590 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1100758448 12:97778113-97778135 TATTAAATTTAATTTGTTGAAGG - Intergenic
1101310976 12:103578936-103578958 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1101551395 12:105765657-105765679 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1101797590 12:107990064-107990086 TGTTAAATTTAATTCAGCTAAGG - Intergenic
1101920678 12:108930207-108930229 TGTTACATTTAATTTGTCCAAGG - Intronic
1102377800 12:112437641-112437663 TGTTATATTTAGTTTGTAAAAGG + Intronic
1102526065 12:113513198-113513220 TGTTAACTTTCATTTGTCTAAGG - Intergenic
1104315646 12:127697617-127697639 TATTAATTTTAATTTTTCTTTGG - Intergenic
1104492112 12:129203351-129203373 TGTTAAATTTAATTTGTTTAAGG + Intronic
1104809951 12:131614125-131614147 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1105636822 13:22223723-22223745 TGTTAAATTTAATTTGGCTAAGG + Intergenic
1106206107 13:27596535-27596557 TGTGAAATGGAATTGGTCTAGGG - Intronic
1106600062 13:31180084-31180106 AGTTAAATTTAACTTGTCTAAGG + Intergenic
1106768875 13:32942811-32942833 TTTTATTTTTAATTTTTCTATGG - Intergenic
1106836400 13:33639932-33639954 TGTTAAATTGTACTTGTCAATGG + Intergenic
1106837409 13:33649904-33649926 TGTGAAATATAGTTTGTCTAAGG + Intergenic
1107027120 13:35813489-35813511 TATTAAATATAATTGGTCTATGG - Intronic
1107255343 13:38419457-38419479 TGCTAAATTTAATTTGTCTAAGG - Intergenic
1107255945 13:38427077-38427099 TGTTAAAGTTAATTTGTCTAAGG - Intergenic
1107517308 13:41143067-41143089 TGTTTAACTTAATTTGTGTATGG + Intergenic
1107759806 13:43665844-43665866 TGTCAAATTAAATTTGGCCATGG + Intronic
1107783453 13:43929896-43929918 TTTTAAATTTAATTTCACTGTGG + Intergenic
1107996648 13:45867663-45867685 TGTTAAATTTAATTTGACTACGG + Intergenic
1108405970 13:50102409-50102431 TGTTGAATTTTATTTGCTTAAGG - Intronic
1108554131 13:51576519-51576541 TGTAAAATTTAGTTTGTACATGG + Intergenic
1109019247 13:57064291-57064313 TGCTAAATTTTATTTTTCTTTGG - Intergenic
1109241473 13:59895050-59895072 TATAAATTTTAATTTGTTTAAGG - Intronic
1109372090 13:61436043-61436065 TGTTTAATTTAATTTAAATATGG + Intergenic
1109999112 13:70171037-70171059 TGTTAAATTTAATTTGTATAAGG - Intergenic
1110596322 13:77324840-77324862 ATTTAAATTTATTTTGTGTATGG - Intronic
1111000532 13:82174022-82174044 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1111016237 13:82385951-82385973 TGTTTAAGCTGATTTGTCTATGG - Intergenic
1111036602 13:82682371-82682393 TGTTAAATCTATTTCTTCTAGGG - Intergenic
1111118904 13:83820878-83820900 TGTTATATTTAAATTGTTTCAGG + Intergenic
1111247147 13:85554580-85554602 TGTATAATTTAAGTTGTCTGTGG - Intergenic
1111324790 13:86680020-86680042 TGTTAAATAAAAATTGTGTAAGG - Intergenic
1111347969 13:86987570-86987592 TGGTTAATTTACTTTGTTTAGGG - Intergenic
1111400469 13:87727469-87727491 TGTTGTTTTTAATTTGTCTGAGG - Intergenic
1111427273 13:88103534-88103556 TGATAAATATAATCTGCCTATGG - Intergenic
1111433744 13:88179385-88179407 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1111477659 13:88774329-88774351 TTTTAAATTTAATTCGGCTGAGG - Intergenic
1112557798 13:100484964-100484986 TGTGAAATTTAAGTCGTCTCAGG - Intronic
1112810357 13:103211411-103211433 TTTTTAAATTAATTTGTCTTGGG + Intergenic
1114502060 14:23177535-23177557 TGTTAAATTTAATTTGTTTAAGG + Intronic
1114789750 14:25644004-25644026 TGTTTATTTAAATTTTTCTATGG + Intergenic
1114836334 14:26206922-26206944 TATTAAACTTAATTTGTCCAAGG + Intergenic
1114849575 14:26367779-26367801 TTGTACATTTAATTTGTTTATGG - Intergenic
1115092269 14:29592010-29592032 CTTTAAATTTACTTTATCTATGG - Intronic
1115380336 14:32730108-32730130 GGTTAAATCTAATATGTTTAGGG - Intronic
1115578296 14:34732791-34732813 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1115603883 14:34981538-34981560 TGTTAAATTTAACTTGGCTAAGG + Intergenic
1115870627 14:37798156-37798178 TGTTAAATTTAGCTTGCCCAAGG + Intronic
1115908215 14:38224850-38224872 TAGTTAAATTAATTTGTCTAAGG - Intergenic
1116098414 14:40402996-40403018 TGTAATATTTTATTTCTCTAAGG + Intergenic
1116132466 14:40874070-40874092 TGCTAAATTTAATTTATCTAAGG + Intergenic
1116311931 14:43338333-43338355 TGTTAAATTAAATTTGTCTATGG + Intergenic
1116343266 14:43753752-43753774 TGCTAAACTTAACTTGTCTAAGG - Intergenic
1116523071 14:45872675-45872697 TGTTACCTTTAATTTCTGTAGGG + Intergenic
1118059470 14:62119143-62119165 TTTCAAATTTAATTTGCATAAGG + Intergenic
1118283201 14:64447869-64447891 TGGTAAATATAATTTGGGTAAGG + Intronic
1118658077 14:67975517-67975539 AGTTATATTTAATTTGGTTAAGG - Intronic
1118973210 14:70654681-70654703 TGCTAAATTTAATTTGTCTGAGG - Intronic
1120444348 14:84575738-84575760 TGTTAAATTTAATTTATCTAAGG - Intergenic
1120568421 14:86087982-86088004 TGTTAACTTTTATTTGTTTCTGG + Intergenic
1121388154 14:93549572-93549594 TGTTAAATATAATTTGTCTAAGG - Intronic
1121589105 14:95086553-95086575 TATAAAATTTAAATTGTCTGTGG + Exonic
1124788087 15:32700448-32700470 TGTTCAGTTTAATCTGTCTAAGG - Intergenic
1124822085 15:33056284-33056306 TGTTAAACTTAATTTGGCTAAGG - Intronic
1124907883 15:33888708-33888730 TATTAATTTTAAATTGCCTATGG + Intronic
1124989576 15:34658258-34658280 TCTTAAAATTAATCTCTCTATGG - Intergenic
1125214378 15:37253602-37253624 AGTTAAATTTAATTTATCTAAGG - Intergenic
1125451596 15:39813633-39813655 AGTTAAATATGATGTGTCTAGGG + Intronic
1125588278 15:40837613-40837635 TCTTAAATTTAATTTGACTATGG - Intergenic
1125959530 15:43817789-43817811 TGTTACAAATAATTTGTTTAAGG - Intronic
1126718565 15:51550870-51550892 TGGTAAATTAAATTTTTCTTAGG - Intronic
1126882232 15:53111506-53111528 AGTTAAATTTACTTTGTTTTTGG + Intergenic
1127020566 15:54743011-54743033 TGTCTATTTTAATTTGTTTAAGG - Intergenic
1127572565 15:60258528-60258550 TGTTAAATTTAATTTGACTAAGG + Intergenic
1127742732 15:61928566-61928588 TGTTAAATTATAAATGTCTAAGG - Intronic
1128359382 15:66950368-66950390 TGTTAAGTTTAATTTGTTGAAGG + Intergenic
1128464791 15:67901206-67901228 TGTTAAATTAAATTTGTCTAAGG - Intergenic
1128601938 15:69002365-69002387 TGTTAAATTTAATTCATCTAAGG - Intronic
1129136088 15:73553129-73553151 TGTTACTCATAATTTGTCTAAGG + Intronic
1129383354 15:75181802-75181824 TTTTAATTTTAATTTTTGTAGGG - Intergenic
1130243361 15:82219542-82219564 TGGTAGATTTAGTTTGTCTCTGG - Intronic
1130399847 15:83540621-83540643 TTTTAAATTTAAAATTTCTATGG + Intronic
1130457108 15:84121757-84121779 TGGTAGATTTAGTTTGTCTCTGG + Intergenic
1131471502 15:92701535-92701557 TGTTAAATTTAATTTGTCTATGG - Intronic
1131705356 15:94989393-94989415 TGTTCAATTTGATTAGTCTTTGG + Intergenic
1131737311 15:95347573-95347595 TGTTAAATTTAATTTGTGAAAGG + Intergenic
1131848629 15:96514464-96514486 AGTTAAATTTAACTTGTCCTAGG - Intergenic
1131951724 15:97688837-97688859 TTTTAAATTTAATTTGTCTAAGG - Intergenic
1132088659 15:98928922-98928944 TGTTTATTTTAAATTGTCTGTGG + Intronic
1132168207 15:99618934-99618956 TGTGAAATTTAAATTGTGAAAGG + Intronic
1134266321 16:12695879-12695901 TGTGAACTTTAATTTGTCTAAGG + Intronic
1134423802 16:14119078-14119100 TATTATATTTAATTTGTCTAAGG - Intronic
1134505122 16:14799048-14799070 TGTTAAATTTAACATTCCTAGGG + Intronic
1134575454 16:15329862-15329884 TGTTAAATTTAACATTCCTAGGG - Intergenic
1134726991 16:16426630-16426652 TGTTAAATTTAACATTCCTAGGG + Intergenic
1134899125 16:17918966-17918988 TGTTTAATTCAATTTGTCTCTGG - Intergenic
1134940446 16:18285226-18285248 TGTTAAATTTAACATTCCTAGGG - Intergenic
1135038085 16:19095070-19095092 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1135553524 16:23416663-23416685 TGTTAAATTTAACTTGTCTAAGG + Intronic
1135750274 16:25053083-25053105 TCTTCCATTTAATTTGTTTAAGG + Intergenic
1135853911 16:25988940-25988962 TGTGAAATTTAACTTGTCTGAGG - Intronic
1135979601 16:27137173-27137195 TGTTACATTTAGTTTCTATAAGG + Intergenic
1137660022 16:50197276-50197298 ACTTAAATTTAATTTGGCTAAGG - Intronic
1137907508 16:52338375-52338397 TCTTTAATTAATTTTGTCTAAGG - Intergenic
1138819071 16:60236467-60236489 TGGTAAATTTAATTTGCCTAAGG + Intergenic
1138888343 16:61108920-61108942 AGGTAAATTTAATTTTTCAAAGG + Intergenic
1138936434 16:61730956-61730978 TTTTAAAAATAATTAGTCTATGG + Intronic
1139086116 16:63588171-63588193 TGTTAAGTTTTCTGTGTCTAAGG - Intergenic
1139103592 16:63799810-63799832 TGTTAAATTTATTCTTTCTATGG + Intergenic
1140019470 16:71224531-71224553 TGTTAAATTTAATTTGGCTAAGG + Intronic
1141075390 16:81002002-81002024 TATGAAACTTAATTTTTCTAAGG - Intronic
1143938730 17:10515680-10515702 CATTAAGTTTAATTTGTTTATGG - Intronic
1144083644 17:11787058-11787080 TGTTAAACTTAATTTAGCTAAGG - Intronic
1144233033 17:13228233-13228255 TGTTAAATTTAATGTTTCTAAGG - Intergenic
1144309940 17:14004295-14004317 CTTTAAATTTAACTGGTCTAGGG - Intergenic
1144367406 17:14557556-14557578 TGTGAAACTTAATTTGGCTAAGG - Intergenic
1144391117 17:14794227-14794249 TGTAAAACTTAATTTGGCTAAGG + Intergenic
1145114018 17:20191446-20191468 TGTTAATTTGAAATTGCCTACGG + Intronic
1146817967 17:35959468-35959490 TGTTTTATAAAATTTGTCTAGGG - Intergenic
1146823643 17:36004652-36004674 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1147053742 17:37817887-37817909 TGTTACATTTACTCTCTCTAAGG - Intergenic
1147463495 17:40591495-40591517 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1147463997 17:40596543-40596565 TGTTAAATTTAATTTGCCTAAGG + Intergenic
1147802178 17:43099957-43099979 TGGTCAATTTATTTTGTCCATGG - Intronic
1148250370 17:46073615-46073637 TGTTAATTTTTATTTTTGTATGG - Intronic
1148982947 17:51595007-51595029 TATTAAATTTCATTTGGCTAAGG - Intergenic
1149140501 17:53427695-53427717 TGTTAAATTACATTTGTCTAAGG - Intergenic
1149171219 17:53813928-53813950 TGTTAAATTCAGTTTTTCTCTGG + Intergenic
1149342851 17:55704390-55704412 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1150198254 17:63324625-63324647 TGTTTTATAAAATTTGTCTAGGG + Intronic
1150540922 17:66098304-66098326 TGTTCAATTTAATTTCTTTAAGG + Intronic
1152148830 17:78586301-78586323 GGTTACATTTAATTTGTCTAAGG + Intergenic
1152169654 17:78736109-78736131 TGTTAAATAAAATGTGTCTAAGG - Intronic
1153184623 18:2472568-2472590 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1153304791 18:3621752-3621774 TGTTAAGCTTAATTTGGCTAAGG + Intronic
1153552703 18:6278811-6278833 TGTTCAAATTAATTTCTATAGGG + Intronic
1154264653 18:12869697-12869719 TGTTAAATTTTAATTTTATAAGG + Intronic
1154314214 18:13291421-13291443 TGTACAATTTGATTTGTCCAAGG - Intronic
1154994749 18:21629410-21629432 TGCCAAATTTAATTTGTCTAAGG - Exonic
1155768419 18:29667480-29667502 TTTTAAATTAATTTTGTATATGG + Intergenic
1156256496 18:35402475-35402497 AGTTAAATTTTGTTTCTCTAGGG + Intergenic
1156785345 18:40906013-40906035 TGGTAAATCTAATCTGACTAAGG - Intergenic
1156889106 18:42169403-42169425 TGTCAAATATAATTTGGCTCTGG - Intergenic
1156890292 18:42183150-42183172 TGTTTAATTTAATTTGTCTAAGG + Intergenic
1156905350 18:42345925-42345947 TATTACCTTTAATTTATCTAAGG - Intergenic
1156976785 18:43231814-43231836 TGTTAAATTTGATTTGTCTCAGG - Intergenic
1157929653 18:51807649-51807671 TGTTCAAATTAATTTGTCTAAGG + Intergenic
1158084644 18:53636635-53636657 TCCTAAATTTGATTTGCCTAAGG - Intergenic
1158097887 18:53795272-53795294 TGTTACGTTTATTTTTTCTAGGG - Intergenic
1158422845 18:57311554-57311576 CTTTAAATTTAATTTGGCTAAGG + Intergenic
1158455490 18:57603596-57603618 TGTTAACTTTAATTTATGTGTGG - Intronic
1158468356 18:57712125-57712147 TGTTAAATTTGATGTTCCTATGG - Intronic
1158641734 18:59209364-59209386 TTTTAACTTTAATTTATCTTTGG - Intergenic
1158880297 18:61772443-61772465 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1158924610 18:62241545-62241567 TGTTAAATCTAATATGCCTAAGG + Intronic
1159271333 18:66155645-66155667 TTTTAAATTTAATTCGGCTCAGG - Intergenic
1159313588 18:66741133-66741155 TGTTATTTTTAATGTGTATAAGG - Intergenic
1159407328 18:68021218-68021240 AATTAAATTTATTTTGTGTAAGG + Intergenic
1159655484 18:71027085-71027107 TGTTCAATTTAAATTGTTTCAGG - Intergenic
1159798963 18:72873377-72873399 TGTTATAATTAATATGTGTAAGG + Intergenic
1159836434 18:73342475-73342497 TGTTAAATTTAATTTGGCTAAGG + Intergenic
1159943055 18:74423788-74423810 TGTTAAATTTAATAAGATTATGG - Intergenic
1160087515 18:75790508-75790530 TGTTAAAGTATATTTGTGTAAGG + Intergenic
1160354421 18:78214936-78214958 TATTAAATTTAATGTGTCTTAGG + Intergenic
1162229670 19:9255639-9255661 TATTAAATTTAATTTGTCTAAGG + Intergenic
1162892548 19:13744427-13744449 TGTTATCTTTAATTTCTATAGGG + Intronic
1163305860 19:16478439-16478461 TTTTTAATTTAATTTTTATAGGG - Intergenic
1164650554 19:29887984-29888006 TGTCCAGTTTAATTTGTCTGTGG - Intergenic
1164658744 19:29943391-29943413 TGTTAAATCTGATTTTTCTGTGG + Intronic
1164946714 19:32300830-32300852 TGTTAGGTTTATTTGGTCTAAGG + Intergenic
1167616564 19:50537629-50537651 TGTTAAAGTTAAATTGACAAAGG - Intronic
925175169 2:1778144-1778166 TGTTAAATTTAATTTGGCTAAGG + Intergenic
925596661 2:5562108-5562130 AATTAAATTTCATTTGTCCAAGG - Intergenic
925648161 2:6059413-6059435 TTTAAAATTTAAGTTATCTAAGG - Intergenic
925815814 2:7747718-7747740 TGTGAAATTTAATTCGTCTAAGG - Intergenic
926578720 2:14611425-14611447 TTTTAAAAGTATTTTGTCTATGG - Intergenic
927766787 2:25817534-25817556 TGATTAATTTAATTTGGGTAGGG + Intronic
928930014 2:36614838-36614860 TGTTACATTTAATGTGTCTAAGG - Intronic
929019214 2:37533892-37533914 TGTTAACTTTAAAATGTGTAAGG - Intergenic
932658243 2:73628867-73628889 TGTTAAATTTAGTTTGTCTAAGG + Intergenic
932664872 2:73688915-73688937 TGTTAAATTTAGTTTGTCTAAGG + Intergenic
932681870 2:73832963-73832985 TGTTAAATTTAACTTGTCTAAGG - Intronic
932956168 2:76353252-76353274 TGTTAAATTTAATTTGGTTAAGG + Intergenic
933157020 2:78987808-78987830 TTTTAAATTTAATTTAGATATGG - Intergenic
933257941 2:80101995-80102017 TGTTAATTTTAATTTTTTTGTGG + Intronic
933374612 2:81463629-81463651 TCTTAAGTTTTATTTCTCTAAGG + Intergenic
934051054 2:88211350-88211372 TGTTAAATTTAATTTGTCTAAGG + Intergenic
934870483 2:97860754-97860776 TGTTAAATTTAGTATTTCTGTGG - Intronic
935542624 2:104367622-104367644 TTTTTAATTTAATTTGTTTTGGG - Intergenic
937088753 2:119190727-119190749 TGTTAAATTTAATCTGGTTAAGG - Intergenic
937617854 2:123947173-123947195 CTTTAAATTTATTTTGTCTGAGG - Intergenic
939067195 2:137498162-137498184 TGTGAAATTAAATTAATCTATGG + Intronic
939129132 2:138213128-138213150 TGTTCAGTTTAATTTGTCTAAGG - Intergenic
939131746 2:138243418-138243440 TGTGAAATTTAATTTGTCTAAGG - Intergenic
939167045 2:138651310-138651332 TGTTAAATTTAATTTGTCTAAGG + Intergenic
939283893 2:140103132-140103154 TGTTAACTATAATTTCTCTAGGG + Intergenic
939497210 2:142938288-142938310 GGATAAATTTAATTTGGTTAAGG - Intronic
939565705 2:143784280-143784302 TGTAAAATTTTATTTTTCCAAGG + Intergenic
940027831 2:149227206-149227228 TGTTAAATTTAATTTGTCTAAGG + Intergenic
941051875 2:160743854-160743876 TGTTAAAATTTATTTGACTAGGG + Intergenic
941311492 2:163937884-163937906 TGTTAAATTTAATGCGTCTAAGG - Intergenic
941318564 2:164025988-164026010 TGTTAAGTTTGAGATGTCTATGG + Intergenic
941512054 2:166423955-166423977 TGTCAACCTTAATTTGACTATGG + Intronic
942177582 2:173349281-173349303 TGCTAAATTTAATTTGTCTAAGG - Intergenic
942243646 2:173987285-173987307 TGTTAGATTTAATTTCTTCAGGG + Intergenic
942700491 2:178702952-178702974 TTTAAAATTTAATTTGACTTTGG - Intronic
943579416 2:189667413-189667435 TGTTGAAATTAATGTTTCTATGG + Exonic
943825311 2:192383824-192383846 TGTTGAATGTGATTTGTCCAAGG + Intergenic
943875315 2:193060458-193060480 TGTTAAATTTTATTTTTGTGGGG + Intergenic
944753033 2:202731204-202731226 TGCTCAATATAATTTGTCAATGG + Intronic
945079448 2:206074060-206074082 TAATAAATTTAGTTTGGCTAAGG - Intronic
945581387 2:211599723-211599745 TGTGCAATCTAATTTGGCTAAGG - Intronic
946077911 2:217091030-217091052 TATTAATTTTGATTTATCTAAGG + Intergenic
946348868 2:219134732-219134754 TGTTGAATTTAAATTGATTATGG - Intronic
946498513 2:220220485-220220507 TGTTAAATTTAATTTGGCTAAGG - Intergenic
946856274 2:223952920-223952942 TCTTAAATTTAATTTGTCTAAGG + Intergenic
946870600 2:224081016-224081038 TGCTTAATTTAATTTGTATTGGG - Intergenic
947374310 2:229480402-229480424 TGTTTAATTAAATTTGTAAATGG - Intronic
947891364 2:233624078-233624100 TGTTAAATGTTATGTTTCTATGG + Intronic
947896311 2:233676424-233676446 TGTTAAATCTCATGTTTCTATGG + Intronic
948310176 2:236979466-236979488 TGTTAAATTTAATTTGGCTAAGG + Intergenic
948538730 2:238669299-238669321 TGTTAAATTTAATTTGGCTAAGG + Intergenic
1169707387 20:8520990-8521012 TTCTATATTTAATTTGTCTTAGG - Intronic
1169733854 20:8815419-8815441 TGATAAATTTAACTTGCCCATGG - Intronic
1169883762 20:10375457-10375479 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1169935232 20:10876588-10876610 GGGTATAATTAATTTGTCTAAGG - Intergenic
1170058606 20:12234836-12234858 AGTTAAATTTAAGTTGTCACAGG - Intergenic
1170405751 20:16034169-16034191 AGTTAAATTTATTTAGTTTATGG + Intronic
1170609199 20:17898154-17898176 TTTTAAAATTATTTTTTCTAGGG - Intergenic
1170825879 20:19794894-19794916 ATTTTAATTTAATTTTTCTATGG - Intergenic
1170912627 20:20589452-20589474 TATTAAATTTAAATATTCTAAGG + Intronic
1170992166 20:21312901-21312923 TGTGTTATTTAATTTATCTAGGG - Intronic
1170993638 20:21329788-21329810 TTTTAAATTTCATTTTTCTTAGG + Intronic
1172145030 20:32751368-32751390 TGATAAATGTAATTTGGTTATGG + Intergenic
1174921766 20:54710786-54710808 TCTTAATTTTAATCTGTTTAAGG + Intergenic
1175208757 20:57333508-57333530 AGTTAAAATTAATTGCTCTATGG - Intronic
1175556947 20:59870625-59870647 TTTTAGAATTAGTTTGTCTAAGG - Intronic
1175790685 20:61738213-61738235 AGTTAGATTTAATTTCTCTCTGG + Intronic
1176670601 21:9731656-9731678 TGTTGAATTTAATTTGGCTAAGG + Intergenic
1176884967 21:14244472-14244494 GGTTAAATGTATTTTGTGTATGG + Intergenic
1176921792 21:14696532-14696554 TGTTTAATTTGTCTTGTCTATGG - Intergenic
1176988938 21:15470903-15470925 TATTAAATTTAAATTTTCCAGGG - Intergenic
1177087259 21:16721488-16721510 TGGTAAATTTCACTTCTCTATGG + Intergenic
1177188957 21:17828240-17828262 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1177276125 21:18914557-18914579 TGTTAAATTTAACTTGTCTTGGG - Intergenic
1177286911 21:19063467-19063489 TGTGAAACCTAATTCGTCTAAGG + Intergenic
1177612886 21:23475656-23475678 CGCTAAATTTAATTTTTCTGCGG + Intergenic
1177673110 21:24259448-24259470 TGTATATTTTAATTTGTCTCAGG + Intergenic
1177747376 21:25234857-25234879 TGTTTAATTCACTTAGTCTATGG - Intergenic
1177847549 21:26308189-26308211 TGTTAAATCTATTTTTTCCAAGG - Intergenic
1177993758 21:28070915-28070937 TTTTAAATGTAAAATGTCTATGG + Intergenic
1178401368 21:32287840-32287862 TTTTAAATGTAATTTGCCAATGG + Intergenic
1178555331 21:33585701-33585723 TGTTAAATTATTTTTCTCTAAGG - Intronic
1178557684 21:33607663-33607685 TTTTATTTTTAATTTGTCTTTGG - Intronic
1179659200 21:42863775-42863797 TGTGAAAGTAAATTTGTCGAAGG - Intronic
1180027362 21:45174737-45174759 TTTTAAATTTTATTTATTTATGG - Intronic
1181453560 22:23039642-23039664 TGTTAAATTTAATTTGGCTGAGG - Intergenic
1181454186 22:23046931-23046953 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1183653151 22:39170509-39170531 TGTTAAATTTATTTTTTTTAGGG - Intergenic
1184407309 22:44307485-44307507 GGATAAATTTAATCTGTCTCTGG - Intronic
1184933982 22:47705456-47705478 TGAAAAATCTAATTTGTCAAGGG + Intergenic
949162967 3:903320-903342 TGTTAGATTCATTTTGACTATGG - Intergenic
949390587 3:3558105-3558127 AGTTAAATTTAAATGGTCTGGGG - Intergenic
949470904 3:4395414-4395436 TGTTTAATTTTATTTATCTCTGG + Intronic
950847464 3:16028859-16028881 TTTTATTTTTAATTTATCTAAGG + Intergenic
951154508 3:19333329-19333351 TGTTAAATTTTAATAGTATATGG - Intronic
951233658 3:20209600-20209622 TGTTAGATTCAATTTTTTTATGG + Intergenic
951448907 3:22814336-22814358 AGTTAAATTTAAACTGTCTAAGG - Intergenic
951916887 3:27810475-27810497 TGTTAAATATATTTTATCTCAGG + Intergenic
952036413 3:29207305-29207327 TATGAAATTTAATTTGTCCAAGG - Intergenic
952162241 3:30705646-30705668 TGTTATCTTTAATTTCTATAGGG - Intergenic
952982537 3:38749296-38749318 AGGTCAGTTTAATTTGTCTAGGG + Intronic
954815201 3:53274871-53274893 TTTTAAATTTATTTTGTATAAGG + Intergenic
955079273 3:55642774-55642796 TGTTAAATTCACATTGTATATGG + Intronic
956409947 3:68968825-68968847 TGTTAAATTTAATGTGGCTAAGG + Intergenic
956528401 3:70189806-70189828 TGCTAAATCTAATGTGCCTACGG - Intergenic
956535360 3:70269630-70269652 ATGTTAATTTAATTTGTCTAAGG + Intergenic
957225371 3:77437373-77437395 ACTGAAATTTAATGTGTCTAGGG + Intronic
957373244 3:79323581-79323603 TGTTAAATATCATTTGTAGAGGG + Intronic
957408535 3:79805315-79805337 TGTTTAATTTAATTTCCATATGG - Intergenic
957682681 3:83457962-83457984 TGTTAAATTTAATGTTTGTCAGG + Intergenic
957733152 3:84169191-84169213 TGTTAAATTTTAATCTTCTAGGG + Intergenic
957963138 3:87286522-87286544 TGTTAAAATTAGTATGTTTATGG - Intergenic
958529030 3:95300653-95300675 TGTTAAATTTAACTTGTTTAAGG + Intergenic
958747669 3:98156918-98156940 TGTAAAATTCAATTTGTTTTGGG - Intergenic
958918869 3:100080455-100080477 TATAAAATTGAAATTGTCTAGGG - Intronic
959082648 3:101818188-101818210 TTTTAAATTTAATTTTTAGAAGG + Intronic
959531310 3:107437422-107437444 TTTTAAATTTATTTTGGGTAAGG + Intergenic
959905243 3:111703883-111703905 TGCAAAATTCAATTTGCCTAAGG + Intronic
959952910 3:112201066-112201088 TATAAAACTTAATTTGTCAAAGG + Intronic
960418455 3:117413987-117414009 TGTGATATTTAATTAGTCAACGG - Intergenic
960693313 3:120370463-120370485 TGTTAAATTTCATTTATCTTGGG + Intergenic
960725906 3:120669824-120669846 TGTTAAATTAGATTTGTCAAAGG + Intronic
961242023 3:125419379-125419401 TGCTAAATTTAATTTGGCCAAGG + Intergenic
961242999 3:125428579-125428601 TGTTAAATTTAATTTGGCTAAGG + Intergenic
961344280 3:126252426-126252448 TATAAAATTTAATTTGGCTAAGG + Intergenic
962013134 3:131412999-131413021 TGTTAAATTCATTTGTTCTAAGG - Intergenic
962167297 3:133062964-133062986 TGTGGAATTTAAATTGGCTAAGG + Intronic
963087582 3:141452754-141452776 TGTTACATTTAACTTGTTTAAGG - Intergenic
963177491 3:142315442-142315464 TTTTTAATGTAATTTGTCTAAGG - Intronic
963337412 3:143992002-143992024 TGTGAAATTTATTTTATCTTTGG + Exonic
963363882 3:144310010-144310032 TCTTAAATTTACTTCCTCTATGG + Intergenic
963470470 3:145735535-145735557 TGATAAATTGGCTTTGTCTAGGG - Intergenic
963747571 3:149140995-149141017 TGTTACATTTTATTTTTTTAAGG + Exonic
963809568 3:149762318-149762340 TGTTAAATTAGAAGTGTCTATGG - Intronic
963843949 3:150135921-150135943 TATTAAAATTAATTTCTCTGAGG + Intergenic
963981160 3:151538661-151538683 TTTTAAATTAAATTTCTTTATGG - Intergenic
964005187 3:151818395-151818417 TGTTAAATTTAATTTGTCTAAGG - Intronic
964069630 3:152615965-152615987 CGTTAAATTTAATTTGTCTAAGG + Intergenic
964268335 3:154926566-154926588 TGTTAAATTTCAGTTGTCTGAGG - Intergenic
964353542 3:155827183-155827205 TATTAGATTTAATTTGTCAAAGG + Exonic
965015548 3:163152805-163152827 TGTTAAATTCATTTGCTCTAAGG + Intergenic
965116582 3:164497415-164497437 AGTTAAATTTCATTTGTCTAAGG - Intergenic
965117040 3:164503267-164503289 TGTGAAATTTCATTTGTCTGAGG - Intergenic
965213586 3:165829610-165829632 TATGAAATTGAATTTGTCTTTGG - Exonic
965222656 3:165947146-165947168 AGTAAGCTTTAATTTGTCTATGG - Intergenic
965856514 3:173094982-173095004 TGTAAAATTTTATTTGTAAAGGG + Intronic
965887591 3:173466751-173466773 AGTTTAATTTTAATTGTCTATGG - Intronic
965956959 3:174382222-174382244 TGTTAAATTTAATTTGTCTAAGG + Intergenic
966460130 3:180167233-180167255 TGTTAGATCTATTTAGTCTATGG + Intergenic
967222523 3:187259507-187259529 TTTTAAATATAATTTTCCTAAGG - Intronic
967328692 3:188268336-188268358 TGTGGAATTAGATTTGTCTAAGG - Intronic
967427720 3:189346570-189346592 TGTTAAATTTCATTTATTCATGG + Intergenic
968021294 3:195392146-195392168 TTTTATATTTAATTTTTCTAGGG - Exonic
969129152 4:4978591-4978613 TTTTAATTTTAACTTGTCTATGG + Intergenic
969137763 4:5044381-5044403 TGTTAAATTTAAAGGGTCTGTGG - Intergenic
970248303 4:14087466-14087488 CGTTACATTTAATTTGGCTAAGG - Intergenic
970298714 4:14659321-14659343 TGTTACATTTAATTTGTCTAAGG - Intergenic
970410774 4:15806132-15806154 GGTTAAATCCAATTTGTCTGCGG - Intronic
970578283 4:17448790-17448812 TGTTACATTTACTTTGGCTAAGG - Intergenic
971031681 4:22643992-22644014 TGTTAAATTTAATTTCGCCAAGG - Intergenic
971521956 4:27564762-27564784 TGTTAAAATTAATTTTTCTAAGG + Intergenic
971668241 4:29521572-29521594 TGCTAAATTTAACTTGCCTCAGG + Intergenic
971678108 4:29660911-29660933 TATAAAATTTAATGTTTCTATGG + Intergenic
972375977 4:38470935-38470957 CTTTAAATTTGATTTGTCTGAGG + Intergenic
972606768 4:40620647-40620669 TGTTAAATTAGACTTGTCTTTGG - Intronic
972912516 4:43835343-43835365 TGTTAAAATTAATCTGTCTAAGG - Intergenic
973249229 4:48044349-48044371 TGTTCTATTTAATTGGTCTGAGG - Intergenic
973867523 4:55128427-55128449 GATTAAATTAAATTTGTCTTGGG - Intergenic
973893953 4:55394332-55394354 TGTTAAGTTTAATTTGTCTAAGG + Intergenic
974272054 4:59662491-59662513 TGTTAAATTTTCTCTTTCTATGG + Intergenic
974545652 4:63303497-63303519 TGTTTACATTAATTTGCCTATGG + Intergenic
975507213 4:75150718-75150740 TGTTAAGTATAATTTCCCTACGG + Intergenic
975538936 4:75484104-75484126 TGTTAAATTTAATTTGTGTAAGG + Intronic
975566691 4:75763616-75763638 TATTAAATTTATTTTTACTATGG + Intronic
975597112 4:76058799-76058821 TGCTAAATTTAATTTGTCTAAGG - Intronic
976386769 4:84468848-84468870 TGTTTAACTTAATTTTTCCATGG - Intergenic
976938557 4:90670698-90670720 AATTAAATTAAATATGTCTATGG - Intronic
977384377 4:96320339-96320361 TTTTAAAGTTAATATGTATAAGG - Intergenic
977841901 4:101717139-101717161 TGTTAAATCCATTTTTTCTATGG - Intronic
977967924 4:103177165-103177187 TTTAAAATTTTATTAGTCTAAGG + Intronic
978005776 4:103614099-103614121 TCTTAAATTTATTTTTGCTAAGG - Intronic
978215400 4:106195175-106195197 TGTTAAATTTAATTTGTCAAAGG + Intronic
978974704 4:114855433-114855455 TTTTAATTTTATTTTGTGTACGG + Intronic
979020539 4:115491363-115491385 TGTTAATTTTATTTGTTCTAGGG - Intergenic
979118167 4:116854618-116854640 TGTCAAATATCATTTGGCTATGG + Intergenic
979217695 4:118185528-118185550 TGTTAAATTTAATTTGTCTAAGG - Intronic
979219407 4:118204304-118204326 TGTGAAGTTTAATTTGTCTAAGG - Intronic
979235778 4:118398565-118398587 TGCCAAATTTAATTTGGCTAAGG + Intergenic
979248678 4:118539954-118539976 TGTTAAATTCAATTCTTCCATGG - Intergenic
980041018 4:127940393-127940415 TGTATAATTTAAATTGCCTATGG - Intronic
980259508 4:130430259-130430281 TGTTAAATTTAACTTGTCTAAGG - Intergenic
980337246 4:131492252-131492274 TGTTAAATTTAATTTAGGAAAGG + Intergenic
980559772 4:134458363-134458385 TTTTAAATTTCATCTATCTATGG - Intergenic
980982554 4:139667065-139667087 AGTTAAATGTAATTTGTCTAGGG - Intronic
981055568 4:140357595-140357617 TGTTAACCTTAATTTCCCTAAGG + Intronic
981389404 4:144171046-144171068 TGTTAAATTTAAGGTTTCTCTGG + Intergenic
981680111 4:147387977-147387999 TCTTAATTTTTATTTGTTTATGG - Intergenic
981759396 4:148176840-148176862 TATTAAGATTAATTTGTATAGGG - Intronic
982333118 4:154204524-154204546 AGATAAATTTAGTCTGTCTAAGG - Intergenic
982490993 4:156029627-156029649 TTTTAAATTTAATTTGTCCAAGG - Intergenic
982861780 4:160461080-160461102 AGATATATTTGATTTGTCTAAGG - Intergenic
982931768 4:161417049-161417071 TATTTATATTAATTTGTCTATGG + Intronic
982931877 4:161418664-161418686 TGTTCATATTACTTTGTCTATGG + Intronic
983015925 4:162612151-162612173 TGTTACTTTTACTTTATCTATGG - Intergenic
983434337 4:167693051-167693073 TTAAAAATTTAATTTGGCTATGG - Intergenic
983551589 4:169022762-169022784 TATTTAATTTAATTTTTCAAAGG + Intergenic
983772207 4:171565078-171565100 TGTTAAATTTAATTTGTTGAAGG - Intergenic
983953532 4:173670900-173670922 TGTAAAATTTATTTTTTCTTAGG + Intergenic
984022501 4:174502992-174503014 TCTCAGATTTAATATGTCTAGGG - Intronic
984214723 4:176896147-176896169 TGTTAAATTAAATATGTCGGCGG - Intergenic
984245383 4:177268998-177269020 TGTTAAATTATATTTGTCTAAGG - Intergenic
984595501 4:181662917-181662939 TTTTATCTTTAATTGGTCTATGG - Intergenic
984860523 4:184233849-184233871 TATTAAACTTAATTTGGCTAGGG - Intergenic
984860583 4:184234485-184234507 TTTTAAATTTAATTTGGCTAAGG + Intergenic
985059935 4:186067624-186067646 TGGGAAATTTAATCTGTATAAGG + Intergenic
985077966 4:186236821-186236843 AGTCAATTTTAATGTGTCTAAGG + Exonic
985320173 4:188702002-188702024 TGTTCAATTTAATTTGGCAAAGG - Intergenic
985352471 4:189079873-189079895 TGTTTATTTTCATTTGTCTTGGG - Intergenic
985404179 4:189619884-189619906 TGTTGAATTTAATTTGGCTAAGG - Intergenic
985812519 5:2100191-2100213 TGTTATATTTTATTTTCCTATGG + Intergenic
985938454 5:3114544-3114566 TGTTAAATTTAATTTGTCTGAGG - Intergenic
986620699 5:9670588-9670610 TGTTAAATTTAATTTGGCTAAGG + Intronic
986792677 5:11178731-11178753 TGTTAAAATTAATTAGACTCAGG + Intronic
986794846 5:11200012-11200034 GGTTAAATTTAATAAGTCTAGGG - Intronic
987002517 5:13674477-13674499 TGATAAAATTAATTTGGTTAGGG - Intergenic
987030194 5:13969813-13969835 TGTTAAATCTATTTGTTCTAGGG + Intergenic
987178546 5:15342187-15342209 TGCTACATTTAATTGGTCAAAGG - Intergenic
987591056 5:19926942-19926964 TGTTTAATTTAATTAGACTATGG - Intronic
987623109 5:20362644-20362666 TGTTAAATTCAAACTGTCTAGGG + Intronic
987853323 5:23385430-23385452 TGTTAAATTTAATTTGGCTAAGG + Intergenic
987978804 5:25053130-25053152 TGCTAAATTTAATTTATCTAAGG + Intergenic
987984193 5:25124656-25124678 AAATAACTTTAATTTGTCTAAGG - Intergenic
988087576 5:26490960-26490982 TGTTAAATTAACTTTGGCTAAGG - Intergenic
988147341 5:27327731-27327753 GGTTAGATTTAATTTGTATCTGG - Intergenic
988243609 5:28647610-28647632 TTTCAAATTTAATTTGTTTTTGG - Intergenic
988299264 5:29402304-29402326 TGTTAAAATTTATTTATCCATGG - Intergenic
988360827 5:30234505-30234527 TGTTAAATTGAATTCTGCTAAGG - Intergenic
988929537 5:36023334-36023356 TGTTAAGTTTATTTGTTCTAGGG + Intergenic
989130451 5:38101903-38101925 CTTTAAATTTAATTTGTCTAAGG - Intergenic
989314148 5:40057226-40057248 AGTTAAATTTAAATTATCTGTGG + Intergenic
989444540 5:41511741-41511763 TGTAAATTTTTATTTTTCTATGG + Intergenic
989601350 5:43203611-43203633 TGTTAAACTTAATTTGGCTAAGG + Intronic
989603450 5:43221501-43221523 CTTTAAATTTAATTCATCTAAGG - Intronic
989633799 5:43513316-43513338 TGTTGAGTTTGATTTATCTATGG - Intronic
989776508 5:45214447-45214469 TGCTAAATTTAATTTGCCTCAGG + Intergenic
990052657 5:51526314-51526336 TGTTAATTTTCATTTGGCAAAGG + Intergenic
990277432 5:54212951-54212973 TGTTAAATTAGATGTCTCTAAGG + Intronic
990374409 5:55154812-55154834 TTCTAAAATTAATTTTTCTAAGG - Intronic
990681699 5:58252010-58252032 AGTCCAATTTAATTTGTGTAAGG + Intergenic
991217531 5:64172614-64172636 TGATAAATGTAATTTTTCTATGG + Intronic
991395525 5:66200829-66200851 TATTAAATGTAATTTGTCTAAGG - Intergenic
991402542 5:66268711-66268733 TGTTAAATATATATTTTCTAGGG + Intergenic
991472100 5:66979955-66979977 TGTCATCTTTAATTTGTCGAGGG + Intronic
992022805 5:72641121-72641143 TGTTAAATTTAGTTTGTTTAAGG - Intergenic
992192304 5:74305236-74305258 TATCAAATCGAATTTGTCTAAGG + Intergenic
992435031 5:76748015-76748037 TGTTCGGTGTAATTTGTCTAAGG + Intergenic
993245992 5:85453795-85453817 TCTTAATTTTAAATTGTCTTTGG - Intergenic
993428944 5:87806397-87806419 TGGTAAATTAAATTTTTTTAGGG - Intergenic
994340619 5:98623010-98623032 TGTTAAATTGAATATGTCCTAGG + Intergenic
994673501 5:102792178-102792200 TGTTAAGCTTCATATGTCTAAGG - Intronic
994785237 5:104151456-104151478 TGTTAATTTAAATTTCTTTATGG - Intergenic
994867810 5:105300292-105300314 TGTTAAGCTTAATTTGTCTAAGG - Intergenic
995599652 5:113781452-113781474 TGTTATCTTTAGTTTCTCTAGGG + Intergenic
996842790 5:127866346-127866368 TGTGATAGTTAATTTGACTAAGG - Intergenic
997033874 5:130163685-130163707 TGTTAAGTTTATTTTGGCAAAGG - Intronic
997820515 5:137061864-137061886 AGTTAAATTTAATTTCTCCTGGG - Intronic
997901081 5:137765146-137765168 TGTTAAGTCTATTTTTTCTAGGG - Intergenic
999106565 5:149076145-149076167 TGTGAAGTTTAATTTCTTTAGGG - Intergenic
999487671 5:152015314-152015336 TGTTGAATTTCTTGTGTCTATGG + Intergenic
1000026346 5:157362385-157362407 TGTTATCTTTAATTTCTGTAGGG + Intronic
1000402383 5:160844357-160844379 TGTTAATTTTCATTTGTGTGTGG - Intronic
1000478208 5:161738824-161738846 TCTTAAATTTAATTTGTCCAAGG + Intergenic
1000498065 5:162010809-162010831 TGTTAAATTCATTTGTTCTAGGG + Intergenic
1000683160 5:164212366-164212388 TGTTAAATTATATTTGTTTGGGG + Intergenic
1001014119 5:168125365-168125387 TGTTCCATTTAGTTTGTCTGGGG - Intronic
1001359977 5:171073560-171073582 TGTTTATTTTAATATGTATATGG + Intronic
1003326447 6:5095282-5095304 TGTTAAATTTAGTTTGTCTAAGG - Intergenic
1003332382 6:5140335-5140357 GGTTAAATTTACTTTGTCTAAGG + Intronic
1003746669 6:9009529-9009551 TGTTAAATGTAATTTGTCTAAGG - Intergenic
1003845139 6:10166047-10166069 TGGTAAATTCAATTTGTCTAAGG - Intronic
1003918010 6:10805631-10805653 TGTTTACTTTAATTAGCCTATGG + Intronic
1004118927 6:12800117-12800139 TGTTCTATTTCATTTTTCTATGG - Intronic
1004330171 6:14714024-14714046 GGTTAAATTTTATTTGTCTAAGG - Intergenic
1004773105 6:18809398-18809420 TTTTAAATTTTATGTGTTTAAGG - Intergenic
1004815312 6:19306048-19306070 TGTTAAATTTAATTTCCCTAAGG + Intergenic
1004844825 6:19628785-19628807 TGCCTAATTTAATTTGTCTATGG - Intergenic
1005172770 6:23006998-23007020 AATTAAATATAATTTGTTTATGG - Intergenic
1005702730 6:28418789-28418811 TGTTAATTTTAATTTGCATTAGG - Intergenic
1006274323 6:32989804-32989826 TGTTGAATTTCATTCGTCTAAGG + Intergenic
1006725179 6:36194505-36194527 TGTTGAATTTAATTGCTGTATGG + Intergenic
1007338723 6:41174603-41174625 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1007974866 6:46091125-46091147 TACTGAATTTAATTTGTTTAAGG + Intergenic
1007993922 6:46286365-46286387 TCTTAAATTTAATTTGTCTAAGG + Intronic
1008211833 6:48734053-48734075 TGTTAAATCTAATTTGATTTTGG + Intergenic
1008993436 6:57630379-57630401 ATTTAAATTTAATTTTTTTATGG + Intronic
1009025116 6:57990066-57990088 TGCTGAATTTAATTTGTGTAAGG - Intergenic
1009182041 6:60529467-60529489 ATTTAAATTTAATTTTTTTATGG + Intergenic
1009192216 6:60642934-60642956 TTTTAAATTTAATTTGAGCAAGG + Intergenic
1009200685 6:60741522-60741544 TGTTGAACTTAATTTGTGTAAGG - Intergenic
1009237747 6:61144932-61144954 TGTTTAATTTTATGTGTCAACGG - Intergenic
1009799413 6:68515700-68515722 TGGTAAATTTAATTTTTTTAGGG - Intergenic
1009965776 6:70576477-70576499 TGTATAAGTTAATTTGTGTAAGG - Intronic
1010177693 6:73048746-73048768 TGTAAAATTTCATGTTTCTAAGG - Intronic
1010341336 6:74756304-74756326 TGTTTAATGTAATTTTTCTATGG + Intergenic
1010388484 6:75309652-75309674 TGTTATATTTAAGATGTCTGGGG - Intronic
1010568369 6:77446775-77446797 TTTAATATTTTATTTGTCTAAGG - Intergenic
1010772798 6:79851367-79851389 TGGTATATTTTATGTGTCTAGGG - Intergenic
1011021862 6:82822953-82822975 TGTTTCTTTTAAATTGTCTAGGG - Intergenic
1011243710 6:85299686-85299708 TGTTAAATGTAATTTGTCTAAGG - Intergenic
1011769281 6:90657956-90657978 TATGAAGTTTAATTTGTCTTTGG + Intergenic
1011937673 6:92801303-92801325 TCTTAAATTCACTTTGTCTCAGG - Intergenic
1012041239 6:94206535-94206557 TTTTAAATCTAATTAGACTAGGG - Intergenic
1012821663 6:104091768-104091790 TGTCAAATTTGTTTTCTCTAGGG + Intergenic
1012824555 6:104130627-104130649 TGTTAATTTTTATTAGACTAGGG + Intergenic
1012849695 6:104431841-104431863 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1013411095 6:109884626-109884648 TCTTAAAATTAATTTGGCTAAGG + Intergenic
1013483733 6:110575353-110575375 TGTTAAATTTATTTTGTCTAAGG + Intergenic
1013676158 6:112465299-112465321 TGTTAAACTTAATTTGTCTAAGG - Intergenic
1013755875 6:113460858-113460880 TGTTAAGTTTAATTTGTTTAAGG + Intergenic
1013970217 6:116008925-116008947 TGTTACATTTGATTTGTCTAAGG - Intronic
1014376541 6:120681913-120681935 TGGGAAATTTAATTTTTCCATGG + Intergenic
1014474236 6:121853202-121853224 TTTTAATTTTAATTTTTTTATGG + Intergenic
1014475442 6:121866558-121866580 TGTTGAATTGAATTTATTTAAGG - Intergenic
1014579946 6:123124747-123124769 TGTGAAAATTTATGTGTCTATGG + Intergenic
1014597573 6:123364181-123364203 TGTTAAATATAATTTGGCCAAGG + Intronic
1015114982 6:129637861-129637883 TGTTAAATTTAATTTGTCTAAGG + Intronic
1015714380 6:136176636-136176658 TGTTAATGTTAATTTGTAGATGG + Intronic
1015830033 6:137358858-137358880 TTTTTAATTCAATTCGTCTAGGG + Intergenic
1015831208 6:137370833-137370855 TGTTAAATTTGATTTGTCTAAGG - Intergenic
1015854292 6:137607049-137607071 TGTTAAACTTAATTCAGCTAAGG + Intergenic
1016354141 6:143199800-143199822 TCTTAAATTAGATTTATCTAAGG - Intronic
1016357435 6:143233451-143233473 TGTTAAATTTAACTTGTCTATGG - Intronic
1016482892 6:144501275-144501297 TGTTAAATTTAAGTTTTTCAAGG + Intronic
1016586562 6:145694098-145694120 TGTAAAATTTATTTTGCTTAAGG - Intronic
1016744590 6:147565105-147565127 TTTTAAATTTAATCTGGCTGAGG + Exonic
1017036336 6:150270508-150270530 TGTTAAACTTAATCTGTCTAAGG - Intergenic
1017980698 6:159398921-159398943 CATTAAATTTAATTTTTCTAAGG + Intergenic
1018143058 6:160858915-160858937 TCTTAAATTTAATTTATCTAAGG + Intergenic
1018816042 6:167332050-167332072 TGTTACATTTAATTTATCTAAGG - Intronic
1018841674 6:167521937-167521959 TGTTAAATTTTATGTGTTCACGG + Intergenic
1018841686 6:167522028-167522050 TGTTAAATTTTATGTGTTCACGG + Intergenic
1018841698 6:167522119-167522141 TGTTAAATTTTATGTGTTCACGG + Intergenic
1019009591 6:168833108-168833130 TTTTTAATTTAATTTCTCTGTGG + Intergenic
1019108924 6:169693974-169693996 TGTTAATTTTATTTGTTCTACGG - Intronic
1019180339 6:170183233-170183255 TGTTCAATTTAATTTGTCTAAGG - Intergenic
1020390505 7:7652658-7652680 TGTCTAATTTTGTTTGTCTAGGG + Intronic
1020590748 7:10133598-10133620 AGTTAAATTTATTTTGTATATGG - Intergenic
1020668538 7:11076258-11076280 TGATAAATGTAATTTGTTAAAGG + Intronic
1020696140 7:11416033-11416055 TGTTAAATTTAATTTTTCTGAGG + Intronic
1020699646 7:11463771-11463793 TGTTAAATATAATTTATCTAGGG + Intronic
1020866839 7:13575086-13575108 TGTTAAATTTAATTTCACTAAGG - Intergenic
1021119243 7:16779414-16779436 TTTTAAATTTAATTTGGAAAAGG + Intronic
1021250907 7:18323808-18323830 TGTTAAAGTCAAGTGGTCTATGG - Intronic
1021291890 7:18855624-18855646 TGTTAAATTTATTTAGGCTGTGG + Intronic
1021356941 7:19661045-19661067 TGTTAGGTTTAATTGGCCTATGG - Intergenic
1022210332 7:28202583-28202605 TTTTAAGTTAAATTTGTATATGG - Intergenic
1022216263 7:28265128-28265150 TTTTAAATTTATTTTGGGTAGGG + Intergenic
1022397690 7:30005003-30005025 AGTTAAATTTAATTAGACTTAGG - Intergenic
1022744662 7:33158782-33158804 TGTTAAATTTCATTTGACTAAGG - Intronic
1023041224 7:36174860-36174882 TATTAAATTTAATTTGGCTAAGG - Intronic
1023654933 7:42409691-42409713 TGTTACATTTAACTAGTCTAAGG - Intergenic
1023799841 7:43824364-43824386 TGTTATATTTAATTTGAATTTGG - Intergenic
1024373408 7:48611454-48611476 TGTTAAACTTCTTTTCTCTATGG - Intronic
1024718816 7:52111364-52111386 TGTAAAATTTAATTTGGCTAAGG - Intergenic
1024767510 7:52677520-52677542 TGTGTAATTTAATTTGACTCAGG + Intergenic
1024840669 7:53583597-53583619 TGTTAAATTTAATTTGTGTAAGG + Intergenic
1026026634 7:66750184-66750206 TGTGGATTTTTATTTGTCTAGGG + Intronic
1026142301 7:67716725-67716747 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1026212969 7:68323256-68323278 TGTTATATTTAATTTCCATAGGG + Intergenic
1026504055 7:70967357-70967379 TGTTACTTTTAAGTTGTCCAAGG + Intergenic
1026550414 7:71363670-71363692 TGTTTCATTTAATTTGTCTAGGG - Intronic
1026563422 7:71469382-71469404 TGTGTAATTTAATGTGTCGAAGG - Intronic
1027688254 7:81305894-81305916 TGTTAACTCTAATTTGTTAATGG - Intergenic
1027774898 7:82452185-82452207 TGTTAAATTGAATTTCTATTTGG - Intergenic
1027835036 7:83230814-83230836 AATTAAATTTAATTTTACTAAGG - Intergenic
1027864018 7:83623705-83623727 TTTTAAATTTAATCTATCTCAGG - Intronic
1028045314 7:86110283-86110305 TGTTGTATTTAGTTTATCTAGGG - Intergenic
1028599413 7:92585301-92585323 TGTTAAATTTAACTGGTCTCAGG + Intronic
1028806407 7:95031395-95031417 TGATAATTTTAATTTATCTTGGG + Intronic
1028866638 7:95721214-95721236 TGTCAAGTTTAATCTGGCTAAGG + Intergenic
1029036555 7:97528521-97528543 TAGTACATTTAGTTTGTCTATGG + Intergenic
1029108687 7:98199215-98199237 TGTCAGATTTAATTTGTTGATGG + Intronic
1030155325 7:106448829-106448851 TGTTAAATTTAATTTGCCTAAGG - Intergenic
1030605589 7:111636037-111636059 AGTTAAAAGTAATTTGGCTAAGG + Intergenic
1030976229 7:116126919-116126941 TATTTAATTTATTTTGTCGAAGG - Intronic
1030976389 7:116129167-116129189 TATTTAATTTATTTTGTCGAAGG + Intronic
1031208951 7:118797211-118797233 TGTTTAATTTAATTTGTCTAAGG + Intergenic
1031220148 7:118955412-118955434 TGTTAAATTTATTTGTTCTAGGG + Intergenic
1031320557 7:120321465-120321487 TTTTTAACATAATTTGTCTAAGG + Intronic
1031351234 7:120733976-120733998 TTTTCAATTTAATTTGGCTAAGG - Intronic
1031497871 7:122473405-122473427 TGTTAAACTTAATTAGGCTAAGG + Intronic
1033640501 7:143259264-143259286 CATTAAATTTAAATTGTCTGAGG + Intronic
1033923955 7:146433559-146433581 TGTAAAAATTAGTCTGTCTATGG + Intronic
1034341024 7:150355242-150355264 TGTTAAATTTAATTTATCTAAGG - Intergenic
1035495070 7:159317570-159317592 TGTTAAATTAAATTTGTCTAAGG + Intergenic
1035638900 8:1167640-1167662 TGTGAAAGTTAATTTCTTTAGGG + Intergenic
1036096995 8:5735349-5735371 TGTTTATTTTATTTTGTTTATGG + Intergenic
1036529726 8:9573195-9573217 TGTTAAATTTAATTTGACTAAGG - Intronic
1036999431 8:13700078-13700100 TGTTAAATTTTATTTGTGGGAGG + Intergenic
1037209278 8:16365877-16365899 AGATAAATTTAATTAGTCTTGGG - Intronic
1037222431 8:16540668-16540690 TATAAAATTTAATATGTCTTAGG - Intronic
1037421386 8:18706918-18706940 ATTTAAATTTAATTTTTATAAGG + Intronic
1037467355 8:19173123-19173145 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1038086282 8:24200093-24200115 TTTTAAATTTAATTTTTTTAAGG - Intergenic
1038122627 8:24634943-24634965 TGTTAAATTGAATTTATCAAAGG - Intergenic
1038175410 8:25177770-25177792 TGTTAAATTTAATTTGGCTATGG - Intergenic
1038390673 8:27197407-27197429 TACTAAATATAACTTGTCTAAGG - Intergenic
1038861611 8:31394154-31394176 TGTTATTTTTAATTTCTATAGGG + Intergenic
1040625412 8:49143172-49143194 TTTTCTATTTGATTTGTCTAAGG - Intergenic
1040803225 8:51366483-51366505 TGTTAAACTTAATTTGTCTAAGG + Intronic
1040997374 8:53415537-53415559 TGTTAAATTTAGTTAGTCCAGGG - Intergenic
1041607364 8:59798596-59798618 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1041924264 8:63220326-63220348 TTCTAAAGTTAATTTGTGTATGG + Intergenic
1041964021 8:63653474-63653496 TGTAAAATTCTATTAGTCTATGG - Intergenic
1041987601 8:63944069-63944091 TGTAACATTTAATTTGCCTCAGG + Intergenic
1042465447 8:69124953-69124975 TGTTAAGTCTAATTGTTCTAGGG + Intergenic
1042545954 8:69951687-69951709 TGTTCAACTTAATTTGTTTAAGG + Intergenic
1042700604 8:71608606-71608628 TGTTAAATTTAATTTGTGTAAGG - Intergenic
1043221257 8:77668017-77668039 TGTAAGATTTAATTTTTCTTAGG + Intergenic
1043924961 8:86026385-86026407 TTATAAATTTAAGATGTCTAGGG + Intronic
1044219619 8:89654184-89654206 TGTTGGATTTAATTTGCCAAAGG - Intergenic
1044458875 8:92421527-92421549 TCTTACATTTTATTTTTCTATGG + Intergenic
1044527992 8:93273988-93274010 GGCTACATTTAATTTTTCTAAGG - Intergenic
1044733218 8:95249755-95249777 TGTAACATTTAACTTGTCTTTGG + Intronic
1044756130 8:95463130-95463152 TGTTAAGTTTAATTTGGCTAAGG - Intergenic
1045149870 8:99392698-99392720 TGCTAAAATAAATTTGTTTATGG + Intronic
1045198055 8:99949978-99950000 CGTTAAATTTAATTTGTCTACGG + Intergenic
1045769567 8:105719875-105719897 TGTTAAATTTAATTTGAAAATGG - Intronic
1045844988 8:106623823-106623845 TGTTGAATTTAACTTGTAAAAGG + Intronic
1045920612 8:107524487-107524509 TATTAATTTTAACTTATCTATGG - Intergenic
1045980132 8:108175557-108175579 TATTAAAATTAAATTGTCTATGG + Intergenic
1045987600 8:108266915-108266937 TATTAATTTTCATTTTTCTATGG + Intronic
1046266154 8:111832942-111832964 TATTAAAATTAATTTTGCTAGGG + Intergenic
1046266731 8:111839850-111839872 TATTAAAATTAATTTTGCTAGGG + Intergenic
1046658962 8:116927911-116927933 TATTAATTTTAATTTGTCTAAGG - Intergenic
1046983081 8:120357998-120358020 TGGTAATTTTAATTTGTCAATGG - Intronic
1047037606 8:120956606-120956628 TGTTAAATTTAATCTGCGTCTGG + Intergenic
1047065086 8:121272933-121272955 TTTCAGATTTAATTTGTCTGGGG + Intergenic
1047670249 8:127138294-127138316 TGTGAAATTTAAGTTCTCTGTGG - Intergenic
1047952970 8:129950783-129950805 TGGGAAATTTAATTTGTGTCTGG - Intronic
1048160472 8:132016263-132016285 TGTTAAATTTAAGGTGCCTGGGG + Intergenic
1048316040 8:133363011-133363033 TGTTACATTTAGTTTTTCTAAGG + Intergenic
1048415858 8:134227055-134227077 TGTTAAATTTAGTGTGTCTAAGG + Intergenic
1048527201 8:135213965-135213987 TGTGAAATTTAATTGATTTATGG - Intergenic
1048725420 8:137378010-137378032 TGTTAAATTAAAGTTCTCTCTGG - Intergenic
1048731406 8:137444969-137444991 TGTTAAAAATGATTTTTCTATGG - Intergenic
1050914476 9:11114459-11114481 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1051078953 9:13274450-13274472 GGTTAAATTTGTTTTGTTTAGGG - Intronic
1051453845 9:17229971-17229993 CATTGAATTTAATTTGTCTAAGG - Intronic
1051470708 9:17438127-17438149 ATTCAAATTTAATTGGTCTACGG - Intronic
1051495689 9:17720309-17720331 TGTTAAATTTAATTTGCCTAAGG - Intronic
1051906493 9:22101037-22101059 TTTTAACTTTAATTTGACTGAGG + Intergenic
1051977155 9:22964816-22964838 TGTTGAATGTAATTTGTGTAAGG - Intergenic
1051977607 9:22970907-22970929 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1052055222 9:23898383-23898405 TGTTAAATTTAGTTTCTCTAAGG - Intergenic
1052088614 9:24298445-24298467 TGTTACATTTAATTACTCTCAGG - Intergenic
1052089483 9:24310753-24310775 TGTTTTATTTACTTTTTCTATGG + Intergenic
1052196390 9:25720328-25720350 TGTAAAATTTATATTGTCTTAGG - Intergenic
1052248143 9:26363391-26363413 TTTTAAATTTAATGTGTCTAAGG - Intergenic
1052716077 9:32119068-32119090 TGTTAAATACAATGTGTATAGGG - Intergenic
1052725129 9:32220152-32220174 TTTTAAACTTAATTTGGCTAAGG - Intergenic
1052749566 9:32475649-32475671 TTTTAAATTAATTTTGTATAAGG - Intronic
1052968322 9:34359922-34359944 TCTTAATTTTTATTTGTCCAAGG - Intergenic
1053175477 9:35919518-35919540 TGTTGAACTTAGTTAGTCTAAGG - Intergenic
1053257821 9:36633702-36633724 TGCTAAATTTATTTTGTAAATGG - Intronic
1054710545 9:68506470-68506492 TCTTAAGTTTAATTTGTTTAAGG + Intronic
1054771350 9:69087170-69087192 GGTTAAATTTAATTTGTCTAAGG + Intronic
1055128039 9:72742243-72742265 TGTTGAATTAAATTGGTCTGGGG + Intronic
1055463950 9:76545606-76545628 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1055891365 9:81127592-81127614 TGTTAAATAAAATTTGTGAAAGG - Intergenic
1056023964 9:82472474-82472496 TGTTAAATTTAATTTGCCTAAGG + Intergenic
1057665446 9:97041126-97041148 TCTTAAATTTAATTTGGCTATGG + Intergenic
1058155233 9:101507307-101507329 TGATAACTATAATTTGTCTTGGG - Intronic
1058283482 9:103147161-103147183 TTTTATACCTAATTTGTCTAGGG + Intergenic
1058558477 9:106197807-106197829 TCTTAAATTAATTTTGTGTATGG + Intergenic
1059211603 9:112516764-112516786 TGTTAAATTTAATTTGTCTAAGG - Intronic
1059611722 9:115904672-115904694 TGCTGAATTTAATTAGTCTCTGG - Intergenic
1059646966 9:116277171-116277193 TCTTAATTTTAATTTTTTTAAGG - Intronic
1059869416 9:118555176-118555198 TTTTAATTTTAATTTGCATAGGG - Intergenic
1060125267 9:121038664-121038686 TGACAAACTTAATTTCTCTAGGG + Intronic
1203489296 Un_GL000224v1:88006-88028 TGTGAAATTGAACTTGTCTAAGG - Intergenic
1203501917 Un_KI270741v1:29901-29923 TGTGAAATTGAACTTGTCTAAGG - Intergenic
1185846915 X:3446395-3446417 TGTTAAATTTAATTTGTCTAAGG - Intergenic
1185981839 X:4788445-4788467 CTTTAAATTTAATTTGTCTAAGG + Intergenic
1186015973 X:5194408-5194430 TGTTAAATTTAATATGCCTAAGG - Intergenic
1186680307 X:11866329-11866351 TGTTAAATAAAATTTGTGGAAGG - Intergenic
1187567064 X:20461314-20461336 TGTAAATTTTCATTTCTCTAGGG + Intergenic
1187629035 X:21147878-21147900 TTTTAATTTTAGTATGTCTAAGG - Intergenic
1187651763 X:21416908-21416930 ATTTCAATTTCATTTGTCTATGG + Intronic
1187886114 X:23890338-23890360 TTTTAAAATAAATTTGTCAATGG - Intronic
1188033815 X:25294638-25294660 TGTTAAATTTAACTTGCCTAAGG - Intergenic
1188157011 X:26752567-26752589 TGTTAAATTTAATTTGGCTAAGG - Intergenic
1188442280 X:30224260-30224282 TGATATATTTACTTTTTCTAAGG - Intergenic
1188768856 X:34129170-34129192 TGTTAACATTATTTTGGCTATGG + Intergenic
1189161728 X:38816146-38816168 TGCTAAATTTAATTTGTGTAAGG - Intergenic
1189411232 X:40773587-40773609 TGTTAAACTTAATTTGTCTAAGG + Intergenic
1190250548 X:48721066-48721088 TGTTTAGGTTTATTTGTCTAGGG - Intergenic
1190852490 X:54259504-54259526 TGTTAAATTTTATTTATCTTTGG - Intronic
1191139513 X:57101923-57101945 TGTTAAATCTATTTTTTCTAGGG - Intergenic
1192019135 X:67366114-67366136 TGTTAAATCTAATTGGTTTATGG - Intergenic
1192303899 X:69937702-69937724 TTTTAAATTTAATTTGACAGAGG - Intronic
1192537396 X:71939883-71939905 TGTCAAATTTAGGTTGTCTGTGG + Intergenic
1192556075 X:72090418-72090440 TTTAAAACTTAATATGTCTATGG + Intergenic
1192944826 X:75954933-75954955 TGTTAAGTTTATTTGTTCTAGGG + Intergenic
1193170548 X:78330892-78330914 TGTTAACTTTAATTTGTCTAAGG + Intergenic
1193178640 X:78426425-78426447 TGTTGACTATAATTTCTCTATGG - Intergenic
1193256256 X:79352510-79352532 CATTTAATTTAATTTGGCTAGGG + Intergenic
1193620063 X:83741188-83741210 TATTAGATTTATTTGGTCTATGG - Intergenic
1193676320 X:84457009-84457031 TATTAGATTTATTTGGTCTATGG - Intronic
1193695590 X:84703795-84703817 TCTTAAATTTAATCTGTCTAAGG - Intergenic
1194224703 X:91242371-91242393 TGTTAAGTTCATTTTTTCTAGGG + Intergenic
1194238673 X:91416212-91416234 TGTTGAATTTAACTTGTCTTAGG + Intergenic
1194246399 X:91517429-91517451 TGTTAAATTCAATATGTTTGAGG - Intergenic
1194569280 X:95533308-95533330 TGTTATATTTAATTTGCATAAGG + Intergenic
1194706867 X:97186110-97186132 TGATAAATTTAATTTTTGTTTGG + Intronic
1194910441 X:99636092-99636114 TGATCAATTTTCTTTGTCTATGG - Intergenic
1195200192 X:102542288-102542310 TGTTAAATGTAGTTTCTCCAAGG - Intergenic
1195848229 X:109252583-109252605 TGTTAGATTCATTTTGTCTAAGG + Intergenic
1196286917 X:113893527-113893549 CTTTAAATTTAATTTGGCTAAGG + Intergenic
1197019221 X:121666512-121666534 TGTTAAATTTAATTTGTCTAAGG + Intergenic
1197351193 X:125385282-125385304 TGCTAAATTTAATTTGTCTAAGG + Intergenic
1197680480 X:129377686-129377708 TGTTAAATTTAGTCTTTCTGTGG - Intergenic
1198040918 X:132851595-132851617 TGTGATATTTAAATTGTCTCTGG - Intronic
1198104767 X:133451549-133451571 TGTTAAATTTAATTTAGCTAAGG + Intergenic
1198697999 X:139364471-139364493 TGTTTAATTTGATGTGTCTGTGG - Intergenic
1199106268 X:143872931-143872953 TGTTCAAATTAATGTTTCTATGG - Intergenic
1199340905 X:146675991-146676013 CTTTTCATTTAATTTGTCTAGGG + Intergenic
1199427293 X:147717660-147717682 TGCTAAATTTAATGAGTCTAGGG - Intergenic
1199483224 X:148321505-148321527 TGTTAAAATAAATTGGTCCATGG - Intergenic
1199553422 X:149080777-149080799 TGTTAAAATAAATGTGTCTTAGG + Intergenic
1199700806 X:150374154-150374176 TGTTATTTTTCAATTGTCTAAGG - Intronic
1199918421 X:152370147-152370169 TGATAAAATGAATTTGTCTTTGG - Intronic
1200561167 Y:4705681-4705703 TGTTAAGTTCATTTTTTCTAGGG + Intergenic
1200565362 Y:4758673-4758695 TGTTAAATTCAATATGTTTGAGG - Intergenic
1200817553 Y:7549212-7549234 TGTTACATTTAATTTGTCTAAGG + Intergenic
1202574934 Y:26313852-26313874 TTTTAAATTTATTTTTTCTAAGG - Intergenic