ID: 1101551396

View in Genome Browser
Species Human (GRCh38)
Location 12:105765693-105765715
Sequence CAAAGAATGATTCGTGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101551395_1101551396 13 Left 1101551395 12:105765657-105765679 CCTTAGACAAATTAAATTTAACA 0: 35
1: 91
2: 86
3: 108
4: 548
Right 1101551396 12:105765693-105765715 CAAAGAATGATTCGTGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101551396 Original CRISPR CAAAGAATGATTCGTGTATC AGG Intergenic
No off target data available for this crispr