ID: 1101554066

View in Genome Browser
Species Human (GRCh38)
Location 12:105790709-105790731
Sequence GTGATGATCAGTTGACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101554066_1101554067 -7 Left 1101554066 12:105790709-105790731 CCATGGTGTCAACTGATCATCAC No data
Right 1101554067 12:105790725-105790747 TCATCACCATGCACTCCTGCAGG No data
1101554066_1101554068 -6 Left 1101554066 12:105790709-105790731 CCATGGTGTCAACTGATCATCAC No data
Right 1101554068 12:105790726-105790748 CATCACCATGCACTCCTGCAGGG No data
1101554066_1101554072 9 Left 1101554066 12:105790709-105790731 CCATGGTGTCAACTGATCATCAC No data
Right 1101554072 12:105790741-105790763 CTGCAGGGTCCAGAGTGGATAGG No data
1101554066_1101554070 4 Left 1101554066 12:105790709-105790731 CCATGGTGTCAACTGATCATCAC No data
Right 1101554070 12:105790736-105790758 CACTCCTGCAGGGTCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101554066 Original CRISPR GTGATGATCAGTTGACACCA TGG (reversed) Intergenic