ID: 1101554067

View in Genome Browser
Species Human (GRCh38)
Location 12:105790725-105790747
Sequence TCATCACCATGCACTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101554066_1101554067 -7 Left 1101554066 12:105790709-105790731 CCATGGTGTCAACTGATCATCAC No data
Right 1101554067 12:105790725-105790747 TCATCACCATGCACTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101554067 Original CRISPR TCATCACCATGCACTCCTGC AGG Intergenic