ID: 1101554067 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:105790725-105790747 |
| Sequence | TCATCACCATGCACTCCTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1101554066_1101554067 | -7 | Left | 1101554066 | 12:105790709-105790731 | CCATGGTGTCAACTGATCATCAC | No data | ||
| Right | 1101554067 | 12:105790725-105790747 | TCATCACCATGCACTCCTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1101554067 | Original CRISPR | TCATCACCATGCACTCCTGC AGG | Intergenic | ||