ID: 1101555516

View in Genome Browser
Species Human (GRCh38)
Location 12:105805214-105805236
Sequence ATTTCTATGCAGAAGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101555516_1101555518 4 Left 1101555516 12:105805214-105805236 CCTATCACCTTCTGCATAGAAAT No data
Right 1101555518 12:105805241-105805263 GATGACATCCCACTGCCTTCAGG No data
1101555516_1101555522 19 Left 1101555516 12:105805214-105805236 CCTATCACCTTCTGCATAGAAAT No data
Right 1101555522 12:105805256-105805278 CCTTCAGGATGAGTCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101555516 Original CRISPR ATTTCTATGCAGAAGGTGAT AGG (reversed) Intergenic
No off target data available for this crispr